Transcript: Mouse NM_009230.3

Mus musculus sterol O-acyltransferase 1 (Soat1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Soat1 (20652)
Length:
4785
CDS:
212..1834

Additional Resources:

NCBI RefSeq record:
NM_009230.3
NBCI Gene record:
Soat1 (20652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197536 CCAACCAGAGACTAAACATAT pLKO.1 2133 3UTR 100% 13.200 9.240 N Soat1 n/a
2 TRCN0000336269 CCAACCAGAGACTAAACATAT pLKO_005 2133 3UTR 100% 13.200 9.240 N Soat1 n/a
3 TRCN0000336399 GAATATCCCACGAGTACTAAA pLKO_005 1000 CDS 100% 13.200 9.240 N Soat1 n/a
4 TRCN0000336332 GTTCTCACCCATTGATCTATT pLKO_005 819 CDS 100% 13.200 9.240 N Soat1 n/a
5 TRCN0000178477 GCGTAGTGACTTTCCTTGTTA pLKO.1 2928 3UTR 100% 5.625 3.938 N Soat1 n/a
6 TRCN0000353388 GCGTAGTGACTTTCCTTGTTA pLKO_005 2928 3UTR 100% 5.625 3.938 N Soat1 n/a
7 TRCN0000177641 CCAATCTGGAACATCATGGTT pLKO.1 1670 CDS 100% 3.000 2.100 N Soat1 n/a
8 TRCN0000197396 CCTTTGGTCTAATTGCTTTAT pLKO.1 2899 3UTR 100% 13.200 7.920 N Soat1 n/a
9 TRCN0000336330 CCTTTGGTCTAATTGCTTTAT pLKO_005 2899 3UTR 100% 13.200 7.920 N Soat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01576 pDONR223 100% 82.2% 85.4% None (many diffs) n/a
2 ccsbBroad304_01576 pLX_304 0% 82.2% 85.4% V5 (many diffs) n/a
3 TRCN0000471228 ATTGCGAATAGACCTACGTGCCAT pLX_317 27.9% 82.2% 85.4% V5 (many diffs) n/a
4 TRCN0000488886 TAAGCCTAATATATTGCACCGCGA pLX_317 24.2% 82.2% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488688 CACCGAGCGGTTAATCGTTAAAGT pLX_317 22.8% 82.2% 85.2% V5 (many diffs) n/a
Download CSV