Transcript: Mouse NM_009535.3

Mus musculus YES proto-oncogene 1, Src family tyrosine kinase (Yes1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Yes1 (22612)
Length:
4608
CDS:
676..2301

Additional Resources:

NCBI RefSeq record:
NM_009535.3
NBCI Gene record:
Yes1 (22612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339152 TGGTTATATCCCTAGCAATTA pLKO_005 1086 CDS 100% 13.200 18.480 N Yes1 n/a
2 TRCN0000023614 GCGGAAAGATTACTTCTGAAT pLKO.1 1171 CDS 100% 4.950 6.930 N Yes1 n/a
3 TRCN0000339150 GCGGAAAGATTACTTCTGAAT pLKO_005 1171 CDS 100% 4.950 6.930 N Yes1 n/a
4 TRCN0000023616 GCTGCTCTGTATGGTCGATTT pLKO.1 1996 CDS 100% 10.800 8.640 N Yes1 n/a
5 TRCN0000339084 GCTGCTCTGTATGGTCGATTT pLKO_005 1996 CDS 100% 10.800 8.640 N Yes1 n/a
6 TRCN0000197092 GACTACTTCACTGCTACAGAG pLKO.1 2251 CDS 100% 4.050 3.240 N YES1 n/a
7 TRCN0000121244 TCCCTCCATGAATTGATGAAT pLKO.1 2167 CDS 100% 5.625 3.938 N YES1 n/a
8 TRCN0000023615 CCAGGTACAATGATGCCAGAA pLKO.1 1594 CDS 100% 4.050 2.835 N Yes1 n/a
9 TRCN0000339083 CCAGGTACAATGATGCCAGAA pLKO_005 1594 CDS 100% 4.050 2.835 N Yes1 n/a
10 TRCN0000121230 GCAGATTCCATTCAGGCAGAA pLKO.1 1117 CDS 100% 4.050 2.835 N YES1 n/a
11 TRCN0000023618 CCTTGTATGATTATGAAGCTA pLKO.1 962 CDS 100% 3.000 2.100 N Yes1 n/a
12 TRCN0000023617 GCCAGTCATTATGGAGTGGAA pLKO.1 760 CDS 100% 2.640 1.848 N Yes1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01787 pDONR223 100% 91.1% 95.9% None (many diffs) n/a
2 ccsbBroad304_01787 pLX_304 4.9% 91.1% 95.9% V5 (many diffs) n/a
3 TRCN0000468660 CCTCACAGCATATCTTCAATGCAC pLX_317 26.1% 91.1% 95.9% V5 (many diffs) n/a
4 ccsbBroadEn_14878 pDONR223 0% 91.1% 95.9% None (many diffs) n/a
5 ccsbBroad304_14878 pLX_304 37.4% 91.1% 95.9% V5 (many diffs) n/a
6 TRCN0000471113 TACTGTGATCAAACCCTAGACCTT pLX_317 24.4% 91.1% 95.9% V5 (many diffs) n/a
Download CSV