Transcript: Mouse NM_011101.3

Mus musculus protein kinase C, alpha (Prkca), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Prkca (18750)
Length:
8385
CDS:
222..2240

Additional Resources:

NCBI RefSeq record:
NM_011101.3
NBCI Gene record:
Prkca (18750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235974 CCGGCCAGTGGATGGTATAAA pLKO_005 1029 CDS 100% 15.000 21.000 N Prkca n/a
2 TRCN0000235973 ATGAGTCCTTCACGTTCAAAT pLKO_005 892 CDS 100% 13.200 18.480 N Prkca n/a
3 TRCN0000361430 CCGGCGACTGTCTGTAGAAAT pLKO_005 932 CDS 100% 13.200 18.480 N Prkca n/a
4 TRCN0000235976 ATACACTGCTGAGGGTTAAAT pLKO_005 5141 3UTR 100% 15.000 12.000 N Prkca n/a
5 TRCN0000361428 GAATCGACCAGAGATAGTAAA pLKO_005 2594 3UTR 100% 13.200 10.560 N Prkca n/a
6 TRCN0000235975 CATTCAGCAAGTCGGGAAATT pLKO_005 1505 CDS 100% 13.200 9.240 N Prkca n/a
7 TRCN0000022875 CGGACTGTTCTTCCTTCATAA pLKO.1 1568 CDS 100% 13.200 9.240 N Prkca n/a
8 TRCN0000361364 CTTAGTGGATGATGACATAAA pLKO_005 2428 3UTR 100% 13.200 9.240 N Prkca n/a
9 TRCN0000218783 GGACTGTTCTTCCTTCATAAA pLKO_005 1569 CDS 100% 13.200 9.240 N Prkca n/a
10 TRCN0000361363 AGCTGGTCATTGCTAACATAG pLKO_005 2146 CDS 100% 10.800 7.560 N Prkca n/a
11 TRCN0000196909 GCTGTACTTCGTCATGGAATA pLKO.1 1457 CDS 100% 10.800 7.560 N PRKCA n/a
12 TRCN0000022876 GCTAACATAGACCAATCTGAT pLKO.1 2157 CDS 100% 4.950 3.465 N Prkca n/a
13 TRCN0000022878 CAACCACCATTCAAGCCCAAA pLKO.1 2052 CDS 100% 4.050 2.835 N Prkca n/a
14 TRCN0000361362 CAACCAAGAAGAGGGCGAATA pLKO_005 1055 CDS 100% 10.800 6.480 N Prkca n/a
15 TRCN0000233512 GGGACCTCATGTACCACATTC pLKO_005 1489 CDS 100% 10.800 6.480 N PRKCA n/a
16 TRCN0000022874 CCTTATGTGAAGCTGAAACTA pLKO.1 801 CDS 100% 5.625 3.938 N Prkca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01281 pDONR223 100% 91% 99.5% None (many diffs) n/a
2 TRCN0000472511 CAAAGCGAGGGGGAGCATCGCTTC pLX_317 22.4% 91% 99.5% V5 (many diffs) n/a
3 ccsbBroad304_01281 pLX_304 33.6% 91% 67% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489154 CGCAACGTCAAACTGACCTGCCAT pLX_317 20.3% 91% 99.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14788 pDONR223 72.5% 90.6% 32.5% None (many diffs) n/a
6 ccsbBroad304_14788 pLX_304 26.3% 90.6% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000475052 TTCAATCGGTGGGAGACCACTGAG pLX_317 18.9% 90.6% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV