Transcript: Mouse NM_013646.2

Mus musculus RAR-related orphan receptor alpha (Rora), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rora (19883)
Length:
10878
CDS:
22..1593

Additional Resources:

NCBI RefSeq record:
NM_013646.2
NBCI Gene record:
Rora (19883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222416 CCGAAGACGAAATCGCGTTAT pLKO.1 1268 CDS 100% 10.800 15.120 N Rora n/a
2 TRCN0000022155 CCAAACGCATTGATGGATTTA pLKO.1 1034 CDS 100% 13.200 9.240 N RORA n/a
3 TRCN0000022157 GAATCCATTATGGTGTCATTA pLKO.1 266 CDS 100% 13.200 9.240 N RORA n/a
4 TRCN0000222419 CACACACATCTCAAATTGAAA pLKO.1 209 CDS 100% 5.625 3.938 N Rora n/a
5 TRCN0000222420 CAGTCGGGATTGGACATCAAT pLKO.1 712 CDS 100% 5.625 3.938 N Rora n/a
6 TRCN0000055024 CAGACATTGTGCGACTCCATT pLKO.1 1508 CDS 100% 4.950 3.465 N Rora n/a
7 TRCN0000055023 CTTGCCCAGAACATATCCAAA pLKO.1 847 CDS 100% 4.950 3.465 N Rora n/a
8 TRCN0000222418 CTACAGAAGAACCACCGAGAA pLKO.1 1390 CDS 100% 4.050 2.835 N Rora n/a
9 TRCN0000055026 TGTCTACGTTAAGAGCCCTAT pLKO.1 1442 CDS 100% 4.050 2.835 N Rora n/a
10 TRCN0000222417 CCATCAAGATTACAGAAGCTA pLKO.1 992 CDS 100% 3.000 2.100 N Rora n/a
11 TRCN0000055025 CCGAGGTATCTCAGTCACGAA pLKO.1 183 CDS 100% 2.640 1.848 N Rora n/a
12 TRCN0000055027 GTGGAGACAAATCGTCAGGAA pLKO.1 248 CDS 100% 2.640 1.848 N Rora n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3433 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488554 CCGGAAAGGCAAATATTAGTTTAT pLX_317 22.8% 91% 97.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491974 CACAAGTCCTCGTCATGAGGGAAC pLX_317 17.3% 80.7% 86.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13944 pDONR223 100% 80.7% 86.6% None (many diffs) n/a
4 ccsbBroad304_13944 pLX_304 0% 80.7% 86.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV