Transcript: Human NM_014602.3

Homo sapiens phosphoinositide-3-kinase regulatory subunit 4 (PIK3R4), mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
PIK3R4 (30849)
Length:
5016
CDS:
559..4635

Additional Resources:

NCBI RefSeq record:
NM_014602.3
NBCI Gene record:
PIK3R4 (30849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000886 CCCTGAACAAGTGCTAAATAA pLKO.1 1377 CDS 100% 15.000 21.000 N PIK3R4 n/a
2 TRCN0000318693 CCCTGAACAAGTGCTAAATAA pLKO_005 1377 CDS 100% 15.000 21.000 N PIK3R4 n/a
3 TRCN0000010562 CGGAGGAGAACTTGCTATATT pLKO.1 1129 CDS 100% 15.000 12.000 N PIK3R4 n/a
4 TRCN0000318621 CGGAGGAGAACTTGCTATATT pLKO_005 1129 CDS 100% 15.000 12.000 N PIK3R4 n/a
5 TRCN0000000887 CCTTCCTGTGTCATCCCAATT pLKO.1 2543 CDS 100% 10.800 8.640 N PIK3R4 n/a
6 TRCN0000196467 GTTAAGATGTACTTGACTAGT pLKO.1 4790 3UTR 100% 0.000 0.000 N PIK3R4 n/a
7 TRCN0000318694 GTTAAGATGTACTTGACTAGT pLKO_005 4790 3UTR 100% 0.000 0.000 N PIK3R4 n/a
8 TRCN0000379837 AGTAGTCAGAAAGGTGTAATT pLKO_005 2995 CDS 100% 13.200 9.240 N PIK3R4 n/a
9 TRCN0000000888 GCACCACCACTTTCTGAATTA pLKO.1 4243 CDS 100% 13.200 9.240 N PIK3R4 n/a
10 TRCN0000318623 GCACCACCACTTTCTGAATTA pLKO_005 4243 CDS 100% 13.200 9.240 N PIK3R4 n/a
11 TRCN0000000885 GTCTCCATATTACTGTTTCAT pLKO.1 4740 3UTR 100% 5.625 3.938 N PIK3R4 n/a
12 TRCN0000195336 CAAGAATCAGCCAGCCAACAA pLKO.1 4830 3UTR 100% 4.950 3.465 N PIK3R4 n/a
13 TRCN0000197017 GCATCTCTTTGCAAGAATCAG pLKO.1 4819 3UTR 100% 4.950 3.465 N PIK3R4 n/a
14 TRCN0000318625 GCATCTCTTTGCAAGAATCAG pLKO_005 4819 3UTR 100% 4.950 3.465 N PIK3R4 n/a
15 TRCN0000196772 GTATATGTTATAGAGGTGAGA pLKO.1 4868 3UTR 100% 2.640 1.848 N PIK3R4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491378 ACCAAGCTCTTGTTATCGCAACCT pLX_317 9.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_08170 pDONR223 100% 99.9% 99.9% None 692C>G n/a
3 ccsbBroad304_08170 pLX_304 0% 99.9% 99.9% V5 692C>G n/a
4 ccsbBroadEn_15054 pDONR223 40.2% 99.5% 18% None (many diffs) n/a
5 ccsbBroad304_15054 pLX_304 0% 99.5% 18% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000473888 ACACCGGTTAATTCCCCAGGGAGA pLX_317 10.1% 99.5% 18% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV