Transcript: Human NM_017719.5

Homo sapiens SNF related kinase (SNRK), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SNRK (54861)
Length:
5188
CDS:
305..2602

Additional Resources:

NCBI RefSeq record:
NM_017719.5
NBCI Gene record:
SNRK (54861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196564 GAGCGTAACATCTGTATTAAA pLKO.1 4371 3UTR 100% 15.000 21.000 N SNRK n/a
2 TRCN0000315107 GGGCGTTAGGAGCAATTATTT pLKO_005 2696 3UTR 100% 15.000 21.000 N SNRK n/a
3 TRCN0000001954 GCAATATCAAGGCCCAGTTTA pLKO.1 1362 CDS 100% 13.200 18.480 N SNRK n/a
4 TRCN0000361463 TCAGATAGTTCATGCTATATC pLKO_005 667 CDS 100% 13.200 18.480 N Snrk n/a
5 TRCN0000024290 GCTCAGATAGTTCATGCTATA pLKO.1 665 CDS 100% 10.800 15.120 N Snrk n/a
6 TRCN0000382255 ATATCTGGAACCTCTTATAAA pLKO_005 2866 3UTR 100% 15.000 10.500 N SNRK n/a
7 TRCN0000194790 CTCTGCTACTTTAGGATAAAT pLKO.1 4097 3UTR 100% 15.000 10.500 N SNRK n/a
8 TRCN0000001953 CACTGAATTGGAACGGATAAA pLKO.1 2449 CDS 100% 13.200 9.240 N SNRK n/a
9 TRCN0000315038 CACTGAATTGGAACGGATAAA pLKO_005 2449 CDS 100% 13.200 9.240 N SNRK n/a
10 TRCN0000195348 CCCAAGTTGAGCAGGTTAAAG pLKO.1 1823 CDS 100% 13.200 9.240 N SNRK n/a
11 TRCN0000315037 CCCAAGTTGAGCAGGTTAAAG pLKO_005 1823 CDS 100% 13.200 9.240 N SNRK n/a
12 TRCN0000315039 CCTAACATCGTCCGCCTTTAT pLKO_005 521 CDS 100% 13.200 9.240 N SNRK n/a
13 TRCN0000001951 GAGCAGGTTAAAGATGAATAT pLKO.1 1831 CDS 100% 13.200 9.240 N SNRK n/a
14 TRCN0000315105 GAGCAGGTTAAAGATGAATAT pLKO_005 1831 CDS 100% 13.200 9.240 N SNRK n/a
15 TRCN0000001955 CTAAAGAGTGTAAAGACCTAA pLKO.1 1020 CDS 100% 4.950 3.465 N SNRK n/a
16 TRCN0000001952 GCACTTAACCTAGAGAGAGAA pLKO.1 2913 3UTR 100% 4.950 3.465 N SNRK n/a
17 TRCN0000196645 GAAAGATTGCTGGATTATATG pLKO.1 333 CDS 100% 13.200 7.920 N SNRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489252 GAAATGTCCACACCCCCCCTTTTC pLX_317 14.4% 99.9% 100% V5 16C>A n/a
2 TRCN0000488970 TGCTAGTCTATTTTCAGTACCAGA pLX_317 15.5% 99.7% 100% V5 (not translated due to prior stop codon) 2295_2296insTGATC n/a
3 ccsbBroadEn_08424 pDONR223 100% 99.7% 99.6% None (many diffs) n/a
4 ccsbBroad304_08424 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
5 TRCN0000475651 CCTCGCCGCGTCTCCTGACATAAT pLX_317 11.1% 99.7% 99.6% V5 (many diffs) n/a
6 ccsbBroadEn_15082 pDONR223 67.1% 93.5% 33.7% None (many diffs) n/a
7 ccsbBroad304_15082 pLX_304 0% 93.5% 33.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV