Transcript: Human NM_018291.4

Homo sapiens FGGY carbohydrate kinase domain containing (FGGY), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FGGY (55277)
Length:
1870
CDS:
72..1727

Additional Resources:

NCBI RefSeq record:
NM_018291.4
NBCI Gene record:
FGGY (55277)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230922 TCGAGCAGTCAGTCAAGTTAA pLKO_005 422 CDS 100% 13.200 18.480 N FGGY n/a
2 TRCN0000230924 GGATCAGCAAAGACCCGATTT pLKO_005 973 CDS 100% 10.800 15.120 N FGGY n/a
3 TRCN0000218124 AGTTGTACAAGGGATTGATTT pLKO_005 275 CDS 100% 13.200 9.240 N FGGY n/a
4 TRCN0000078670 GAAGACTTTGTTGCAGATAAT pLKO.1 708 CDS 100% 13.200 9.240 N FGGY n/a
5 TRCN0000078669 GCCAGAGTATATATGCATATT pLKO.1 1147 CDS 100% 13.200 9.240 N FGGY n/a
6 TRCN0000230925 TGAACACCAGAAGGAGTATTT pLKO_005 1685 CDS 100% 13.200 9.240 N FGGY n/a
7 TRCN0000230923 TGGGATAAGGCGGGACATTTC pLKO_005 555 CDS 100% 10.800 7.560 N FGGY n/a
8 TRCN0000078671 GTGGGTTTCCTTACTGTTGAT pLKO.1 1206 CDS 100% 4.950 3.465 N FGGY n/a
9 TRCN0000078668 CCACAGTTCAAGCCATTGCTT pLKO.1 1348 CDS 100% 3.000 2.100 N FGGY n/a
10 TRCN0000078672 GCTTCACTCATTGATGCCCAT pLKO.1 837 CDS 100% 2.160 1.512 N FGGY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15093 pDONR223 0% 79.6% 79.6% None 1_336del n/a
2 ccsbBroad304_15093 pLX_304 0% 79.6% 79.6% V5 1_336del n/a
3 TRCN0000465658 TCACGGTGTCGTACACAATTGAAG pLX_317 21% 79.6% 79.6% V5 1_336del n/a
4 ccsbBroadEn_14196 pDONR223 100% 79.6% 79.4% None 1_336del;1244A>G n/a
5 ccsbBroad304_14196 pLX_304 0% 79.6% 79.4% V5 1_336del;1244A>G n/a
6 TRCN0000471237 CGTTGCCTAACAATATCCCTCCAC pLX_317 35.6% 79.6% 79.4% V5 1_336del;1244A>G n/a
7 ccsbBroadEn_12196 pDONR223 100% 45.7% 45.7% None 1_897del n/a
8 ccsbBroad304_12196 pLX_304 0% 45.7% 45.7% V5 1_897del n/a
9 TRCN0000467964 CGCCCCGGGGGCGATGGCGACCGA pLX_317 55.6% 45.7% 45.7% V5 1_897del n/a
10 TRCN0000489287 TTCGACCCTCTTCGTTCTTGTCGG pLX_317 43.5% 45.7% 45.7% V5 (not translated due to prior stop codon) 1_897del n/a
Download CSV