Transcript: Human NM_018593.5

Homo sapiens solute carrier family 16 member 10 (SLC16A10), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SLC16A10 (117247)
Length:
10757
CDS:
251..1798

Additional Resources:

NCBI RefSeq record:
NM_018593.5
NBCI Gene record:
SLC16A10 (117247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018593.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038534 GCAGGGTTACTTCGTGACAAA pLKO.1 1562 CDS 100% 4.950 6.930 N SLC16A10 n/a
2 TRCN0000271404 CTTACCTATGGAATCATATTT pLKO_005 758 CDS 100% 15.000 12.000 N SLC16A10 n/a
3 TRCN0000271341 GAAAGAATCTGACTCTATTAT pLKO_005 1774 CDS 100% 15.000 10.500 N SLC16A10 n/a
4 TRCN0000271402 GCGTCTTCACAGACCTATTTG pLKO_005 648 CDS 100% 13.200 9.240 N SLC16A10 n/a
5 TRCN0000038538 GCTACCAGTACCAAAGATAAA pLKO.1 1013 CDS 100% 13.200 9.240 N SLC16A10 n/a
6 TRCN0000271400 ATCCCGTGGATCCATAGTAAG pLKO_005 1655 CDS 100% 10.800 7.560 N SLC16A10 n/a
7 TRCN0000038536 CCTTTGCATACCAGCCTTCAT pLKO.1 792 CDS 100% 4.950 3.465 N SLC16A10 n/a
8 TRCN0000038537 GCTCCCATAGCCTTTGAGTTA pLKO.1 1460 CDS 100% 4.950 3.465 N SLC16A10 n/a
9 TRCN0000271401 TACCTAAACCTCAAGTCTATG pLKO_005 2274 3UTR 100% 0.000 0.000 N SLC16A10 n/a
10 TRCN0000038535 CCTGGTGTGAAGAAGGTTTAT pLKO.1 1310 CDS 100% 13.200 7.920 N SLC16A10 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9410 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9410 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3400 3UTR 100% 4.950 2.475 Y NPHS1 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6432 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 4855 3UTR 100% 4.950 2.475 Y CCDC30 n/a
16 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 9735 3UTR 100% 4.950 2.475 Y LOC400464 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6433 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 8495 3UTR 100% 10.800 5.400 Y SMIM11A n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9408 3UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9408 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9408 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018593.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13065 pDONR223 100% 38.8% 38.6% None 1_942del;1264T>C;1522A>G n/a
2 ccsbBroad304_13065 pLX_304 0% 38.8% 38.6% V5 1_942del;1264T>C;1522A>G n/a
3 TRCN0000474056 CAGTCTAAAACTTGATTTTCAGAA pLX_317 49.6% 38.8% 38.6% V5 1_942del;1264T>C;1522A>G n/a
Download CSV