Transcript: Mouse NM_023324.2

Mus musculus pellino 1 (Peli1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Peli1 (67245)
Length:
3501
CDS:
425..1681

Additional Resources:

NCBI RefSeq record:
NM_023324.2
NBCI Gene record:
Peli1 (67245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077352 GCGAACTCATTGTCTTAGGAT pLKO.1 477 CDS 100% 3.000 4.200 N Peli1 n/a
2 TRCN0000312753 CCCTTTACAGCTCGGATTTAT pLKO_005 866 CDS 100% 15.000 12.000 N Peli1 n/a
3 TRCN0000312755 CAGGACTGCATTGTAAGTTTA pLKO_005 1693 3UTR 100% 13.200 10.560 N Peli1 n/a
4 TRCN0000077348 GCTCCTTTGAATATGCAATTT pLKO.1 2427 3UTR 100% 13.200 10.560 N Peli1 n/a
5 TRCN0000077350 GCTTTAAGACAGGAGATCAAT pLKO.1 1232 CDS 100% 5.625 4.500 N Peli1 n/a
6 TRCN0000311836 GCTTTAAGACAGGAGATCAAT pLKO_005 1232 CDS 100% 5.625 4.500 N Peli1 n/a
7 TRCN0000312817 ACTCATTGTCTTAGGATATAA pLKO_005 481 CDS 100% 15.000 10.500 N Peli1 n/a
8 TRCN0000077351 CAAGGCTATATCAGACTTATT pLKO.1 1640 CDS 100% 13.200 9.240 N Peli1 n/a
9 TRCN0000420488 GACCAGCATAGCATATCATAT pLKO_005 641 CDS 100% 13.200 9.240 N PELI1 n/a
10 TRCN0000077349 CGGTCAACTGAAAGTCCTATT pLKO.1 734 CDS 100% 10.800 7.560 N Peli1 n/a
11 TRCN0000311835 CGGTCAACTGAAAGTCCTATT pLKO_005 734 CDS 100% 10.800 7.560 N Peli1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08714 pDONR223 100% 92.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_08714 pLX_304 0% 92.8% 99.7% V5 (many diffs) n/a
3 TRCN0000478265 GCACACGGTGTACATGGGCGCGGA pLX_317 17.5% 92.8% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_15942 pDONR223 0% 28.1% 29.9% None (many diffs) n/a
5 ccsbBroad304_15942 pLX_304 0% 28.1% 29.9% V5 (many diffs) n/a
6 TRCN0000474918 GTACTAACTACGACCGGACATTTC pLX_317 100% 28.1% 29.9% V5 (many diffs) n/a
Download CSV