Transcript: Mouse NM_023913.2

Mus musculus endoplasmic reticulum (ER) to nucleus signalling 1 (Ern1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ern1 (78943)
Length:
3976
CDS:
121..3054

Additional Resources:

NCBI RefSeq record:
NM_023913.2
NBCI Gene record:
Ern1 (78943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356311 GGAATCCTCTACATGGGTAAA pLKO_005 466 CDS 100% 10.800 15.120 N ERN1 n/a
2 TRCN0000008425 GCTCGTGAATTGATAGAGAAA pLKO.1 2533 CDS 100% 4.950 6.930 N Ern1 n/a
3 TRCN0000232026 CCAGCACAGTGGCCTAAATAG pLKO_005 3710 3UTR 100% 13.200 10.560 N Ern1 n/a
4 TRCN0000232024 ACAAGCATGAGGACGTCATTG pLKO_005 2513 CDS 100% 10.800 8.640 N Ern1 n/a
5 TRCN0000232025 CAGACAGATCTGCGCAAATTC pLKO_005 2767 CDS 100% 13.200 9.240 N Ern1 n/a
6 TRCN0000008427 GCTGAACTACTTGAGGAATTA pLKO.1 1179 CDS 100% 13.200 9.240 N Ern1 n/a
7 TRCN0000232023 ATGGAGCTGAGGGCACAATTG pLKO_005 1856 CDS 100% 10.800 7.560 N Ern1 n/a
8 TRCN0000235530 ATGGAGCTGAGGGCACAATTG pLKO_005 1856 CDS 100% 10.800 7.560 N ERN1 n/a
9 TRCN0000008426 GCCTGACGAAACTTCCCTTTA pLKO.1 401 CDS 100% 10.800 7.560 N Ern1 n/a
10 TRCN0000008428 CCAAATGTGATCCGCTACTTT pLKO.1 1987 CDS 100% 5.625 3.938 N Ern1 n/a
11 TRCN0000232022 TCAAGGACATGGCTACCATTA pLKO_005 1448 CDS 100% 10.800 6.480 N Ern1 n/a
12 TRCN0000008424 CCCACTTCTCTTTCTTTCTAA pLKO.1 3361 3UTR 100% 5.625 3.375 N Ern1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487753 GGGTAATGTACGACTTACACTGTC pLX_317 8.8% 88.4% 92.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491744 GGGGCTGCGAGCAGTATAGCGGCC pLX_317 9.3% 88.3% 92.7% V5 (many diffs) n/a
3 ccsbBroadEn_14634 pDONR223 55.1% 87.9% 24.3% None (many diffs) n/a
4 ccsbBroad304_14634 pLX_304 16.1% 87.9% 24.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000465948 GCCACACCTCTAGATATCTCACAT pLX_317 8.1% 87.9% 24.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV