Transcript: Human NM_024012.3

Homo sapiens 5-hydroxytryptamine receptor 5A (HTR5A), mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
HTR5A (3361)
Length:
4572
CDS:
577..1650

Additional Resources:

NCBI RefSeq record:
NM_024012.3
NBCI Gene record:
HTR5A (3361)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368539 GACATGATGTATCTAACTTAT pLKO_005 1843 3UTR 100% 13.200 18.480 N HTR5A n/a
2 TRCN0000357500 TCGGTCTTCGGAGTGCTTATT pLKO_005 685 CDS 100% 13.200 18.480 N HTR5A n/a
3 TRCN0000009120 CCAATAGCGTCTCACCCATAT pLKO.1 1283 CDS 100% 10.800 15.120 N HTR5A n/a
4 TRCN0000009119 CTTCGTGTACTGGAAGATCTA pLKO.1 1227 CDS 100% 4.950 6.930 N HTR5A n/a
5 TRCN0000011679 CTCTCGGTCTTCGGAGTGCTT pLKO.1 682 CDS 100% 0.880 1.232 N HTR5A n/a
6 TRCN0000009121 CGAGCCTTCCTACGCCGTGTT pLKO.1 1164 CDS 100% 0.000 0.000 N HTR5A n/a
7 TRCN0000357501 GCTACTCCAACTCCTTCTTTA pLKO_005 1556 CDS 100% 13.200 10.560 N HTR5A n/a
8 TRCN0000009118 CGGAGTGCTTATTCTCACCTT pLKO.1 693 CDS 100% 2.640 2.112 N HTR5A n/a
9 TRCN0000368536 TCCTAGTACATATATCCTAAT pLKO_005 2119 3UTR 100% 10.800 7.560 N HTR5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00806 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00806 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480496 GAATTAACCATGATCGGTTTGGTT pLX_317 32.2% 100% 100% V5 n/a
4 TRCN0000489686 AAGACGGACTACGCCATATATGAT pLX_317 40.2% 99.9% 100% V5 (not translated due to prior stop codon) 12T>A n/a
5 TRCN0000489886 GGACTAAGTCGTAGTTTTATGTAA pLX_317 41.1% 99.8% 99.7% V5 12T>A;1071_1072insG n/a
6 ccsbBroadEn_06419 pDONR223 100% 99.8% 99.7% None 12T>A;43C>T n/a
7 ccsbBroad304_06419 pLX_304 0% 99.8% 99.7% V5 12T>A;43C>T n/a
8 TRCN0000475616 CTCTACGGTGATGGTACCTGATTG pLX_317 25.6% 99.8% 99.7% V5 12T>A;43C>T n/a
Download CSV