Transcript: Mouse NM_025822.3

Mus musculus arginine/serine-rich coiled-coil 1 (Rsrc1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rsrc1 (66880)
Length:
3232
CDS:
138..1142

Additional Resources:

NCBI RefSeq record:
NM_025822.3
NBCI Gene record:
Rsrc1 (66880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124886 AGACGTAAAGTCCGGGACAAA pLKO.1 549 CDS 100% 4.950 6.930 N Rsrc1 n/a
2 TRCN0000124887 TCTAGCTCATCCAAATCTATT pLKO.1 1034 CDS 100% 13.200 9.240 N Rsrc1 n/a
3 TRCN0000124885 CTCTAGCTCATCCAAATCTAT pLKO.1 1033 CDS 100% 5.625 3.938 N Rsrc1 n/a
4 TRCN0000124888 GCAGACATTCAGATCAAGTAA pLKO.1 863 CDS 100% 5.625 3.938 N Rsrc1 n/a
5 TRCN0000128437 GCAGACATTCAGATCAAGTAA pLKO.1 863 CDS 100% 5.625 3.938 N RSRC1 n/a
6 TRCN0000281011 GCAGACATTCAGATCAAGTAA pLKO_005 863 CDS 100% 5.625 3.938 N RSRC1 n/a
7 TRCN0000124884 CCATGCTATTAGGAAGTGTAT pLKO.1 2943 3UTR 100% 4.950 3.465 N Rsrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03283 pDONR223 100% 86.8% 91.9% None (many diffs) n/a
2 ccsbBroad304_03283 pLX_304 0% 86.8% 91.9% V5 (many diffs) n/a
3 TRCN0000465673 AAAGGGTATCAGTCACCATAACAA pLX_317 29.2% 86.8% 91.9% V5 (many diffs) n/a
4 ccsbBroadEn_15837 pDONR223 0% 72.3% 76% None (many diffs) n/a
5 ccsbBroad304_15837 pLX_304 0% 72.3% 76% V5 (many diffs) n/a
6 TRCN0000473767 CCCCACCGGGTTAAATCTTCCTCC pLX_317 10.8% 72.3% 76% V5 (many diffs) n/a
Download CSV