Transcript: Mouse NM_026115.4

Mus musculus histone aminotransferase 1 (Hat1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Hat1 (107435)
Length:
1576
CDS:
39..1289

Additional Resources:

NCBI RefSeq record:
NM_026115.4
NBCI Gene record:
Hat1 (107435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026115.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034736 GCTACATGACAGTCTATAATT pLKO.1 688 CDS 100% 15.000 12.000 N HAT1 n/a
2 TRCN0000289747 GCTACATGACAGTCTATAATT pLKO_005 688 CDS 100% 15.000 12.000 N HAT1 n/a
3 TRCN0000231308 ATGTAGAGGCTTTCGAGAATA pLKO_005 530 CDS 100% 13.200 10.560 N Hat1 n/a
4 TRCN0000231309 GATCCGTCCAGAAGCTATTTG pLKO_005 858 CDS 100% 13.200 10.560 N Hat1 n/a
5 TRCN0000231311 TGAACCTCTGATGACCCTAAA pLKO_005 1336 3UTR 100% 10.800 8.640 N Hat1 n/a
6 TRCN0000039274 CCGTGTTGAATATTCATCTAA pLKO.1 290 CDS 100% 5.625 4.500 N Hat1 n/a
7 TRCN0000039277 GCTAGCTTTATTGACGTGGAT pLKO.1 594 CDS 100% 2.640 2.112 N Hat1 n/a
8 TRCN0000231310 GAAGCTACAGACTGGATATTA pLKO_005 1075 CDS 100% 15.000 10.500 N Hat1 n/a
9 TRCN0000231307 GAAGATCTTGCTGTACTATAT pLKO_005 245 CDS 100% 13.200 9.240 N Hat1 n/a
10 TRCN0000039276 GCAAGGATTCAGTGAAGATAT pLKO.1 947 CDS 100% 13.200 9.240 N Hat1 n/a
11 TRCN0000039275 GCAACATGCTAGAAGGGTTTA pLKO.1 1004 CDS 100% 10.800 7.560 N Hat1 n/a
12 TRCN0000039278 CCAGAAGCTATTTGAAACTAA pLKO.1 865 CDS 100% 5.625 3.938 N Hat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026115.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11277 pDONR223 100% 73.4% 74.5% None (many diffs) n/a
2 ccsbBroad304_11277 pLX_304 0% 73.4% 74.5% V5 (many diffs) n/a
3 TRCN0000465718 TCGTTCTATACCCGCCGCTGGTTG pLX_317 9.4% 73.4% 74.5% V5 (many diffs) n/a
4 ccsbBroadEn_15634 pDONR223 0% 38.7% 39.4% None (many diffs) n/a
5 ccsbBroad304_15634 pLX_304 0% 38.7% 39.4% V5 (many diffs) n/a
6 TRCN0000472534 GTTAGCTAACGAGCGGGCCAGACG pLX_317 83.4% 38.7% 39.4% V5 (many diffs) n/a
Download CSV