Transcript: Mouse NM_027722.4

Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 4 (Nudt4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nudt4 (71207)
Length:
3231
CDS:
411..950

Additional Resources:

NCBI RefSeq record:
NM_027722.4
NBCI Gene record:
Nudt4 (71207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081226 CGGAAGCACAGAACATATGTT pLKO.1 672 CDS 100% 0.000 0.000 N Nudt4 n/a
2 TRCN0000081224 CCCAGATAACAATGCCTTGTT pLKO.1 884 CDS 100% 0.495 0.396 N Nudt4 n/a
3 TRCN0000081223 CCACTTAACATTCTATGGTTT pLKO.1 1234 3UTR 100% 4.950 3.465 N Nudt4 n/a
4 TRCN0000050846 GAGTGGTTCAAAGTAGAAGAT pLKO.1 759 CDS 100% 4.950 3.465 N NUDT4B n/a
5 TRCN0000081227 CCGTGAATATAGGAAGGAAGA pLKO.1 736 CDS 100% 4.050 2.835 N Nudt4 n/a
6 TRCN0000081225 GCTGGAGTCAAAGGAAAGCTA pLKO.1 618 CDS 100% 3.000 2.100 N Nudt4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465307 CCGACAAATGACTTCGTTAGGTGT pLX_317 60.3% 89.8% 96.1% V5 (many diffs) n/a
2 ccsbBroadEn_14064 pDONR223 100% 89.2% 46.1% None (many diffs) n/a
3 ccsbBroad304_14064 pLX_304 0% 89.2% 46.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_09782 pDONR223 100% 73.9% 81.6% None (many diffs) n/a
5 ccsbBroad304_09782 pLX_304 0% 73.9% 81.6% V5 (many diffs) n/a
6 TRCN0000471165 TCGTGAAGCGCCATCCACTGCGAA pLX_317 92.3% 73.9% 81.6% V5 (many diffs) n/a
7 ccsbBroadEn_16119 pDONR223 0% 73.5% 81.6% None (many diffs) n/a
8 ccsbBroad304_16119 pLX_304 0% 73.5% 81.6% V5 (many diffs) n/a
9 TRCN0000468380 TTCAACATATTGCCGCGCTGGCAA pLX_317 79.2% 73.5% 81.6% V5 (many diffs) n/a
10 ccsbBroadEn_08486 pDONR223 100% 73.1% 82.2% None (many diffs) n/a
11 ccsbBroad304_08486 pLX_304 0% 73.1% 82.2% V5 (many diffs) n/a
12 TRCN0000471707 AATGTGCACGACCTAGGGATGGTG pLX_317 55% 73.1% 82.2% V5 (many diffs) n/a
Download CSV