Transcript: Human NM_032451.2

Homo sapiens spire type actin nucleation factor 2 (SPIRE2), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SPIRE2 (84501)
Length:
3268
CDS:
77..2221

Additional Resources:

NCBI RefSeq record:
NM_032451.2
NBCI Gene record:
SPIRE2 (84501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246202 AGGAATGCGAACGGCAGTTTC pLKO_005 2559 3UTR 100% 10.800 15.120 N SPIRE2 n/a
2 TRCN0000246205 CTGAAATGGAAGAGATGAATA pLKO_005 1320 CDS 100% 13.200 9.240 N SPIRE2 n/a
3 TRCN0000246206 GAGCTCATCCTGGACTTTATC pLKO_005 1010 CDS 100% 13.200 9.240 N SPIRE2 n/a
4 TRCN0000246203 TGCACTTCCTGTAGCATAAAG pLKO_005 1862 CDS 100% 13.200 9.240 N SPIRE2 n/a
5 TRCN0000246204 TCCAGAGAAGAGACATCTTTC pLKO_005 1977 CDS 100% 10.800 7.560 N SPIRE2 n/a
6 TRCN0000167054 CATGATGAAATGTTGTCTCTA pLKO.1 2850 3UTR 100% 4.950 3.465 N SPIRE2 n/a
7 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2840 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2939 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12824 pDONR223 100% 81.3% 81.2% None 1_393del;885_890delGGTCAT;2131C>T n/a
2 ccsbBroad304_12824 pLX_304 0% 81.3% 81.2% V5 1_393del;885_890delGGTCAT;2131C>T n/a
3 TRCN0000480204 CCATATTCCCACACGGTTTCGACG pLX_317 25.3% 81.3% 81.2% V5 1_393del;885_890delGGTCAT;2131C>T n/a
Download CSV