Transcript: Human NM_033412.4

Homo sapiens solute carrier family 25 member 51 (SLC25A51), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC25A51 (92014)
Length:
1171
CDS:
225..1118

Additional Resources:

NCBI RefSeq record:
NM_033412.4
NBCI Gene record:
SLC25A51 (92014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033412.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218248 TGCTCATCTGGTCAATGATTT pLKO_005 848 CDS 100% 13.200 7.920 N SLC25A51 n/a
2 TRCN0000230320 CACAAGCATCATGACAAATTT pLKO_005 666 CDS 100% 15.000 7.500 Y SLC25A51 n/a
3 TRCN0000230321 CATGGAATTGGAGAGTATTAT pLKO_005 723 CDS 100% 15.000 7.500 Y SLC25A51 n/a
4 TRCN0000230319 TTGGTCTGTATGAGGATTTAT pLKO_005 520 CDS 100% 15.000 7.500 Y SLC25A51 n/a
5 TRCN0000133947 CCACAAGCATCATGACAAATT pLKO.1 665 CDS 100% 13.200 6.600 Y SLC25A52 n/a
6 TRCN0000218030 GAAGGGATGGATTTCGAAATT pLKO_005 442 CDS 100% 13.200 6.600 Y SLC25A51 n/a
7 TRCN0000135087 CAGTTGAGAAGGGATGGATTT pLKO.1 435 CDS 100% 10.800 5.400 Y SLC25A52 n/a
8 TRCN0000134735 GTTTGGTCTGTATGAGGATTT pLKO.1 518 CDS 100% 10.800 5.400 Y SLC25A52 n/a
9 TRCN0000060235 GCAACTTATGAGTTCTTGTTA pLKO.1 1086 CDS 100% 5.625 2.813 Y SLC25A51 n/a
10 TRCN0000060233 CACTGGAAAGAGTTCAGACAT pLKO.1 634 CDS 100% 4.950 2.475 Y SLC25A51 n/a
11 TRCN0000136356 CCATTGATGCAGAAGACAACT pLKO.1 483 CDS 100% 4.950 2.475 Y SLC25A52 n/a
12 TRCN0000060236 CCCATTCAGAAGGTCCTCTTT pLKO.1 372 CDS 100% 4.950 2.475 Y SLC25A51 n/a
13 TRCN0000135539 GAATGGACTCAGCAATGTCTT pLKO.1 770 CDS 100% 4.950 2.475 Y SLC25A52 n/a
14 TRCN0000060234 GCACTTATGTTTGGTCTGTAT pLKO.1 510 CDS 100% 4.950 2.475 Y SLC25A51 n/a
15 TRCN0000133722 GCACTTATGTTTGGTCTGTAT pLKO.1 510 CDS 100% 4.950 2.475 Y SLC25A52 n/a
16 TRCN0000138179 CAGGCTTTCAAGGCACTGAAA pLKO.1 699 CDS 100% 0.495 0.248 Y SLC25A52 n/a
17 TRCN0000060237 GCACTGAAATGTCATGGAATT pLKO.1 711 CDS 100% 0.000 0.000 Y SLC25A51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033412.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09328 pDONR223 100% 99.8% 100% None 880T>C n/a
2 ccsbBroad304_09328 pLX_304 0% 99.8% 100% V5 880T>C n/a
3 TRCN0000470593 TAGGAACGATCGATGTACGAGGCA pLX_317 38.3% 99.8% 100% V5 880T>C n/a
4 ccsbBroadEn_09645 pDONR223 100% 97.7% 96.2% None (many diffs) n/a
5 ccsbBroad304_09645 pLX_304 0% 97.7% 96.2% V5 (many diffs) n/a
6 TRCN0000466448 TAGTGGCTGCGCGCGAACTGTACT pLX_317 39.4% 97.7% 96.2% V5 (many diffs) n/a
7 ccsbBroadEn_10649 pDONR223 100% 45% 33% None (many diffs) n/a
8 ccsbBroad304_10649 pLX_304 0% 45% 33% V5 (many diffs) n/a
9 TRCN0000472625 TAGCACACACGCGCCGGTTGATAT pLX_317 100% 45% 33% V5 (many diffs) n/a
10 ccsbBroadEn_14505 pDONR223 100% 21.8% 20.2% None (many diffs) n/a
11 ccsbBroad304_14505 pLX_304 0% 21.8% 20.2% V5 (not translated due to frame shift) (many diffs) n/a
12 TRCN0000479542 CCCATGTGCTCCACTGGGACTGCC pLX_317 100% 21.8% 20.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV