Transcript: Mouse NM_133906.4

Mus musculus zinc finger with KRAB and SCAN domains 1 (Zkscan1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zkscan1 (74570)
Length:
8261
CDS:
236..1921

Additional Resources:

NCBI RefSeq record:
NM_133906.4
NBCI Gene record:
Zkscan1 (74570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241416 ACCGAAACTCATACCTTATTT pLKO_005 1725 CDS 100% 15.000 21.000 N Zkscan1 n/a
2 TRCN0000217677 GTTAGTGCTCAGGCTAGTTAA pLKO.1 4559 3UTR 100% 13.200 18.480 N Zkscan1 n/a
3 TRCN0000257037 TGCACTATTGACCGCAGATTC pLKO_005 877 CDS 100% 10.800 15.120 N Zkscan1 n/a
4 TRCN0000241417 AGAAGCTTTGAATCGACTAAA pLKO_005 448 CDS 100% 13.200 9.240 N Zkscan1 n/a
5 TRCN0000174701 GAAGACTTGGAACTTGATCTA pLKO.1 629 CDS 100% 4.950 3.465 N Zkscan1 n/a
6 TRCN0000173217 CCATAGCTCAAATCTCATCCT pLKO.1 1558 CDS 100% 2.640 1.848 N Zkscan1 n/a
7 TRCN0000018137 CGCTTCTGTTACCAGAACACT pLKO.1 416 CDS 100% 0.300 0.210 N ZKSCAN1 n/a
8 TRCN0000241418 ACCTACAGGACATGCTATAAT pLKO_005 2885 3UTR 100% 15.000 9.000 N Zkscan1 n/a
9 TRCN0000241415 TCAAGCCTTATCCGCCATAAA pLKO_005 1397 CDS 100% 13.200 7.920 N Zkscan1 n/a
10 TRCN0000100516 GCAGTTTGTAAAGGACTCAAT pLKO.1 7381 3UTR 100% 4.950 2.475 Y Sec61g n/a
11 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1426 CDS 100% 4.950 2.475 Y ZNF254 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01799 pDONR223 100% 85.5% 89.7% None (many diffs) n/a
2 ccsbBroad304_01799 pLX_304 0% 85.5% 89.7% V5 (many diffs) n/a
3 TRCN0000468174 GGCTGATACACAGACCGACTATGA pLX_317 20.7% 85.5% 89.7% V5 (many diffs) n/a
4 ccsbBroadEn_15622 pDONR223 0% 85.4% 89.5% None (many diffs) n/a
5 ccsbBroad304_15622 pLX_304 0% 85.4% 89.5% V5 (many diffs) n/a
6 TRCN0000467809 CCACCCTGTTAGCTGCGGCCAGAG pLX_317 23.6% 85.4% 89.5% V5 (many diffs) n/a
Download CSV