Transcript: Mouse NM_134077.4

Mus musculus RNA binding motif protein 26 (Rbm26), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rbm26 (74213)
Length:
4105
CDS:
476..3427

Additional Resources:

NCBI RefSeq record:
NM_134077.4
NBCI Gene record:
Rbm26 (74213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134077.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305471 TCATATAGAGACCGGTATAAC pLKO_005 965 CDS 100% 13.200 18.480 N Rbm26 n/a
2 TRCN0000123585 CCCTTATTCAATTCGCAACTT pLKO.1 2193 CDS 100% 4.950 6.930 N Rbm26 n/a
3 TRCN0000332141 CCCTTATTCAATTCGCAACTT pLKO_005 2193 CDS 100% 4.950 6.930 N Rbm26 n/a
4 TRCN0000305532 TCCTACTCATCACGGTAATAA pLKO_005 1252 CDS 100% 15.000 12.000 N Rbm26 n/a
5 TRCN0000074523 GCTTAGGCTTTACTATGTATT pLKO.1 3898 3UTR 100% 13.200 10.560 N RBM26 n/a
6 TRCN0000123588 GCTGTGAATACAAAGAGTTAT pLKO.1 698 CDS 100% 13.200 9.240 N Rbm26 n/a
7 TRCN0000332086 GCTGTGAATACAAAGAGTTAT pLKO_005 698 CDS 100% 13.200 9.240 N Rbm26 n/a
8 TRCN0000123586 CCATGCAATAATCACATTCAA pLKO.1 3181 CDS 100% 5.625 3.938 N Rbm26 n/a
9 TRCN0000294099 TACCTGTGTTTCATTAGTATT pLKO_005 3463 3UTR 100% 0.000 0.000 N RBM26 n/a
10 TRCN0000305476 TACCTGTGTTTCATTAGTATT pLKO_005 3463 3UTR 100% 0.000 0.000 N Rbm26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134077.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12441 pDONR223 100% 91.6% 96.8% None (many diffs) n/a
2 ccsbBroad304_12441 pLX_304 0% 91.6% 96.8% V5 (many diffs) n/a
3 ccsbBroadEn_03915 pDONR223 100% 91.3% 96.6% None (many diffs) n/a
4 ccsbBroad304_03915 pLX_304 0% 91.3% 96.6% V5 (many diffs) n/a
5 TRCN0000481379 GGCTGCTAGGCGCTCCTTCTGTTC pLX_317 15.8% 91.3% 96.6% V5 (many diffs) n/a
6 ccsbBroadEn_12440 pDONR223 100% 5.4% 1.5% None (many diffs) n/a
7 ccsbBroad304_12440 pLX_304 0% 5.4% 1.5% V5 (many diffs) n/a
8 TRCN0000466594 ATTCCAGTTGGGATTATAACAGCG pLX_317 100% 5.4% 1.5% V5 (many diffs) n/a
Download CSV