Transcript: Human NM_138418.4

Homo sapiens MAPK regulated corepressor interacting protein 2 (MCRIP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MCRIP2 (84331)
Length:
931
CDS:
165..647

Additional Resources:

NCBI RefSeq record:
NM_138418.4
NBCI Gene record:
MCRIP2 (84331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233237 CACCTGAAGTGCCAGCATTTG pLKO_005 745 3UTR 100% 10.800 7.560 N MCRIP2 n/a
2 TRCN0000233236 GCAGAACTTTGTGCCCATTGA pLKO_005 572 CDS 100% 4.950 3.465 N MCRIP2 n/a
3 TRCN0000238816 CAGCAGTTCCTGGCGAGAATC pLKO_005 612 CDS 100% 3.600 2.520 N MCRIP2 n/a
4 TRCN0000180958 GAACTTTGTGCCCATTGACCT pLKO.1 575 CDS 100% 2.640 1.848 N MCRIP2 n/a
5 TRCN0000238815 ACGAGGAGAATGTCCGCTTTG pLKO_005 445 CDS 100% 6.000 3.600 N MCRIP2 n/a
6 TRCN0000233235 GGCCAAGGCTTGTGTTCAATC pLKO_005 352 CDS 100% 10.800 5.400 Y MCRIP2 n/a
7 TRCN0000179504 GCTTGTGTTCAATCGTGTGAA pLKO.1 359 CDS 100% 4.950 2.475 Y MCRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04381 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04381 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468656 GTTCCTGAATCCCGGAATTACAAA pLX_317 87.6% 100% 100% V5 n/a
4 ccsbBroadEn_16032 pDONR223 0% 46.8% 40.6% None 181_308del;354_480del n/a
5 ccsbBroad304_16032 pLX_304 0% 46.8% 40.6% V5 181_308del;354_480del n/a
6 TRCN0000469309 ATTCTAACCATGTCAATTAAATCT pLX_317 100% 46.6% 39.3% V5 (not translated due to prior stop codon) 181_308del;343G>A;354_480del n/a
7 TRCN0000466834 TTCGGAGGTAGCAAGAGCAATCTT pLX_317 100% 46.2% 31.2% V5 (many diffs) n/a
8 ccsbBroadEn_16031 pDONR223 0% 46% 31.2% None (many diffs) n/a
9 ccsbBroad304_16031 pLX_304 0% 46% 31.2% V5 (many diffs) n/a
Download CSV