Transcript: Mouse NM_138650.2

Mus musculus diacylglycerol kinase, gamma (Dgkg), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dgkg (110197)
Length:
5521
CDS:
459..2825

Additional Resources:

NCBI RefSeq record:
NM_138650.2
NBCI Gene record:
Dgkg (110197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378473 GATGACGTTTCACCGCAAATG pLKO_005 1559 CDS 100% 10.800 15.120 N Dgkg n/a
2 TRCN0000361962 CAGCCACAATGCACGATTAAA pLKO_005 2712 CDS 100% 15.000 10.500 N Dgkg n/a
3 TRCN0000378498 AGCTGTGGTATTTCGAATTTG pLKO_005 2287 CDS 100% 13.200 9.240 N Dgkg n/a
4 TRCN0000024808 CTCCAGAAATACTCTGAATAT pLKO.1 507 CDS 100% 13.200 9.240 N Dgkg n/a
5 TRCN0000024804 GCAGCCACAATGCACGATTAA pLKO.1 2711 CDS 100% 13.200 9.240 N Dgkg n/a
6 TRCN0000024805 CCAGGATTGAACTTCTTTCAT pLKO.1 1869 CDS 100% 5.625 3.938 N Dgkg n/a
7 TRCN0000024807 CCCATACAACATCATGAACAA pLKO.1 2171 CDS 100% 4.950 3.465 N Dgkg n/a
8 TRCN0000024806 CCTGTGCTGCATCTACTGTAA pLKO.1 1346 CDS 100% 4.950 3.465 N Dgkg n/a
9 TRCN0000000515 CTGAGCAACATCTTCCTGGAA pLKO.1 2388 CDS 100% 2.640 1.848 N DGKG n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2873 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14608 pDONR223 68.7% 87% 22.3% None (many diffs) n/a
2 ccsbBroad304_14608 pLX_304 0% 87% 22.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000472503 CTAACACTTAGGATTCGTCAAAGT pLX_317 15.8% 87% 22.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489714 TTCAATTAGCACCCTCCCTTCAGC pLX_317 18.8% 84.7% 86.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_06082 pDONR223 100% 82.8% 84.8% None (many diffs) n/a
6 ccsbBroad304_06082 pLX_304 0% 82.8% 84.8% V5 (many diffs) n/a
7 TRCN0000468267 ATGTATAAGCAAGACATGTATCCG pLX_317 14.2% 82.8% 84.8% V5 (many diffs) n/a
Download CSV