Transcript: Mouse NM_146090.5

Mus musculus zinc binding alcohol dehydrogenase, domain containing 2 (Zadh2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zadh2 (225791)
Length:
3321
CDS:
8..1141

Additional Resources:

NCBI RefSeq record:
NM_146090.5
NBCI Gene record:
Zadh2 (225791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146090.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114303 CGGAACCGATTCGTTGGTATT pLKO.1 209 CDS 100% 10.800 15.120 N Zadh2 n/a
2 TRCN0000324093 CGGAACCGATTCGTTGGTATT pLKO_005 209 CDS 100% 10.800 15.120 N Zadh2 n/a
3 TRCN0000114301 CCTCCCATCTAAATAGACATT pLKO.1 1597 3UTR 100% 4.950 6.930 N Zadh2 n/a
4 TRCN0000324091 CCTCCCATCTAAATAGACATT pLKO_005 1597 3UTR 100% 4.950 6.930 N Zadh2 n/a
5 TRCN0000114302 CGCTTGATAGTGATTGGGTTT pLKO.1 800 CDS 100% 4.050 5.670 N Zadh2 n/a
6 TRCN0000353839 CGCTTGATAGTGATTGGGTTT pLKO_005 800 CDS 100% 4.050 5.670 N Zadh2 n/a
7 TRCN0000114305 CCTACAGGACTCTCACCAATA pLKO.1 839 CDS 100% 10.800 7.560 N Zadh2 n/a
8 TRCN0000324092 CCTACAGGACTCTCACCAATA pLKO_005 839 CDS 100% 10.800 7.560 N Zadh2 n/a
9 TRCN0000114304 GCCACCCTTTGACATAGGTTT pLKO.1 280 CDS 100% 4.950 3.465 N Zadh2 n/a
10 TRCN0000324167 GCCACCCTTTGACATAGGTTT pLKO_005 280 CDS 100% 4.950 3.465 N Zadh2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146090.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09957 pDONR223 100% 84.5% 87.7% None (many diffs) n/a
2 ccsbBroad304_09957 pLX_304 0% 84.5% 87.7% V5 (many diffs) n/a
3 ccsbBroadEn_09958 pDONR223 100% 84.5% 88% None (many diffs) n/a
4 ccsbBroad304_09958 pLX_304 0% 84.5% 88% V5 (many diffs) n/a
5 TRCN0000468811 AATAAAAGCTATTTCATATTATAG pLX_317 31.5% 84.5% 88% V5 (many diffs) n/a
Download CSV