Transcript: Mouse NM_146153.3

Mus musculus thyroid hormone receptor associated protein 3 (Thrap3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Thrap3 (230753)
Length:
4350
CDS:
159..3014

Additional Resources:

NCBI RefSeq record:
NM_146153.3
NBCI Gene record:
Thrap3 (230753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095127 CCGTTCCAATTGGCAGAACTA pLKO.1 479 CDS 100% 4.950 6.930 N Thrap3 n/a
2 TRCN0000316393 CCGTTCCAATTGGCAGAACTA pLKO_005 479 CDS 100% 4.950 6.930 N Thrap3 n/a
3 TRCN0000379291 GCCGATCTGTCTCTCGTTCAA pLKO_005 259 CDS 100% 4.950 6.930 N Thrap3 n/a
4 TRCN0000245251 GTCATAGCCGGTGCAAGCAAA pLKO_005 1515 CDS 100% 4.950 6.930 N Gm15204 n/a
5 TRCN0000022112 GCCTTGATATTGAACGTCGTA pLKO.1 2302 CDS 100% 2.640 3.696 N THRAP3 n/a
6 TRCN0000285546 GCCTTGATATTGAACGTCGTA pLKO_005 2302 CDS 100% 2.640 3.696 N THRAP3 n/a
7 TRCN0000095126 GCTCAGCACATAGTGACCATT pLKO.1 2031 CDS 100% 4.950 3.960 N Thrap3 n/a
8 TRCN0000304907 AGGCACCTCTCAAGATATAAA pLKO_005 782 CDS 100% 15.000 10.500 N Thrap3 n/a
9 TRCN0000245250 TTTGATGATGAGCCCAAATTT pLKO_005 1485 CDS 100% 15.000 10.500 N Gm15204 n/a
10 TRCN0000304906 AGGCTACAGGAGGCCCTATTA pLKO_005 392 CDS 100% 13.200 9.240 N Thrap3 n/a
11 TRCN0000095128 GCCCAAGAGCAAGAAGTATTA pLKO.1 2768 CDS 100% 13.200 9.240 N Thrap3 n/a
12 TRCN0000316462 GCCCAAGAGCAAGAAGTATTA pLKO_005 2768 CDS 100% 13.200 9.240 N Thrap3 n/a
13 TRCN0000375369 TCATATTCTCCAGCTCATAAC pLKO_005 315 CDS 100% 10.800 7.560 N Thrap3 n/a
14 TRCN0000095124 CCCTTTCTACACAGCCATGTA pLKO.1 3641 3UTR 100% 4.950 3.465 N Thrap3 n/a
15 TRCN0000095125 CCAGAGATACACAGGAGGATA pLKO.1 2166 CDS 100% 4.950 2.970 N Thrap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02278 pDONR223 100% 88.7% 92.7% None (many diffs) n/a
2 ccsbBroad304_02278 pLX_304 0% 88.7% 92.7% V5 (many diffs) n/a
3 TRCN0000467356 ACATGAGGTCCACGCCAACTTGTC pLX_317 12.9% 88.7% 92.7% V5 (many diffs) n/a
Download CSV