Transcript: Mouse NM_153458.3

Mus musculus olfactomedin 3 (Olfm3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Olfm3 (229759)
Length:
4689
CDS:
406..1782

Additional Resources:

NCBI RefSeq record:
NM_153458.3
NBCI Gene record:
Olfm3 (229759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153458.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339531 GATGATCGGAAGACGCTAATG pLKO_005 742 CDS 100% 10.800 15.120 N Olfm3 n/a
2 TRCN0000202922 CCATAACCAATACTTTCACAT pLKO.1 1647 CDS 100% 4.950 6.930 N Olfm3 n/a
3 TRCN0000185971 GCCCTATCTATTTATAGTGTA pLKO.1 3816 3UTR 100% 4.950 6.930 N Olfm3 n/a
4 TRCN0000339459 TCATGTTACTCTTACCATATT pLKO_005 2257 3UTR 100% 13.200 10.560 N Olfm3 n/a
5 TRCN0000339456 AGACATCTGGAACTCGATTTG pLKO_005 1040 CDS 100% 10.800 8.640 N Olfm3 n/a
6 TRCN0000339533 GAATAACAGAGTCTGGTATAT pLKO_005 1095 CDS 100% 13.200 9.240 N Olfm3 n/a
7 TRCN0000339458 GCTTGGATGACGGATCCTTTA pLKO_005 1063 CDS 100% 10.800 7.560 N Olfm3 n/a
8 TRCN0000187076 CCCTTCCATAACCAATACTTT pLKO.1 1642 CDS 100% 5.625 3.938 N OLFM3 n/a
9 TRCN0000187544 GCCAGCTTAATCAAGATACCT pLKO.1 1460 CDS 100% 3.000 2.100 N Olfm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153458.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09451 pDONR223 100% 90.9% 98% None (many diffs) n/a
2 ccsbBroad304_09451 pLX_304 0% 90.9% 98% V5 (many diffs) n/a
3 TRCN0000468203 CTACGGACGCCAGGAGGAATACTG pLX_317 22.1% 90.9% 98% V5 (many diffs) n/a
Download CSV