Transcript: Mouse NM_177390.3

Mus musculus myosin ID (Myo1d), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Myo1d (338367)
Length:
5353
CDS:
234..3254

Additional Resources:

NCBI RefSeq record:
NM_177390.3
NBCI Gene record:
Myo1d (338367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100607 CCTTATGTATAACAGCTCAAA pLKO.1 1832 CDS 100% 4.950 6.930 N Myo1d n/a
2 TRCN0000100609 GCCGCTTATTGAGAATGGCAA pLKO.1 1097 CDS 100% 2.640 3.696 N Myo1d n/a
3 TRCN0000100606 GCGTGTATGAATGTTGGCAAA pLKO.1 1608 CDS 100% 4.050 3.240 N Myo1d n/a
4 TRCN0000100608 GCCTTATGTATAACAGCTCAA pLKO.1 1831 CDS 100% 4.050 2.835 N Myo1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10983 pDONR223 100% 38.7% 41.8% None (many diffs) n/a
2 ccsbBroad304_10983 pLX_304 0% 38.7% 41.8% V5 (many diffs) n/a
3 TRCN0000480529 CACGTTTAACACTTGGCGGCCGTT pLX_317 30.2% 38.7% 41.8% V5 (many diffs) n/a
Download CSV