Transcript: Human NM_181607.3

Homo sapiens keratin associated protein 19-1 (KRTAP19-1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP19-1 (337882)
Length:
662
CDS:
51..323

Additional Resources:

NCBI RefSeq record:
NM_181607.3
NBCI Gene record:
KRTAP19-1 (337882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257203 GGCTTTGGAAGCTACGGATAT pLKO_005 195 CDS 100% 10.800 7.560 N KRTAP19-1 n/a
2 TRCN0000244014 GTACAATGGAGGATACGGATT pLKO_005 287 CDS 100% 4.050 2.835 N KRTAP19-1 n/a
3 TRCN0000244013 GGCTTTGGAGGCTACGGATAT pLKO_005 222 CDS 100% 10.800 6.480 N KRTAP19-1 n/a
4 TRCN0000244015 GGCTATGGAGGCTACGGATAT pLKO_005 168 CDS 100% 10.800 5.400 Y KRTAP19-1 n/a
5 TRCN0000244012 GGCTTTGGAGGCTATGGATAT pLKO_005 249 CDS 100% 10.800 5.400 Y KRTAP19-1 n/a
6 TRCN0000257720 GGCTTTGGAGGCTATGGATAT pLKO_005 249 CDS 100% 10.800 5.400 Y Krtap19-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05429 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05429 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465813 GTTACTCAGGCAAATCTAAGTTAT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_05432 pDONR223 100% 70% 63.3% None (many diffs) n/a
5 ccsbBroad304_05432 pLX_304 0% 70% 63.3% V5 (many diffs) n/a
6 TRCN0000467303 CACTCGACAAAGCTGCATTGCTTT pLX_317 100% 70% 63.3% V5 (many diffs) n/a
7 ccsbBroadEn_05433 pDONR223 100% 60.3% 54.4% None (many diffs) n/a
8 ccsbBroad304_05433 pLX_304 0% 60.3% 54.4% V5 (many diffs) n/a
9 TRCN0000466649 AACTCACAACGTTCTGCATCCTTT pLX_317 100% 60.3% 54.4% V5 (many diffs) n/a
10 ccsbBroadEn_09998 pDONR223 100% 49.2% 45.9% None (many diffs) n/a
11 ccsbBroad304_09998 pLX_304 0% 49.2% 45.9% V5 (many diffs) n/a
12 TRCN0000475628 TCAATGGATGGTACCGACACTTTG pLX_317 100% 49.2% 45.9% V5 (many diffs) n/a
Download CSV