Transcript: Human NM_199244.3

Homo sapiens forkhead box D4 like 4 (FOXD4L4), mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
FOXD4L4 (349334)
Length:
1251
CDS:
1..1251

Additional Resources:

NCBI RefSeq record:
NM_199244.3
NBCI Gene record:
FOXD4L4 (349334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255487 CGAGTGACCCTTCAGAGTTTG pLKO_005 239 CDS 100% 10.800 6.480 N FOXD4L4 n/a
2 TRCN0000021033 CCCTTCAGAGTTTGGCACCAA pLKO.1 246 CDS 100% 2.640 1.584 N FOXD4L4 n/a
3 TRCN0000021029 CGGATGCTTCTCTTTCAGCAT pLKO.1 959 CDS 100% 0.264 0.158 N FOXD4L4 n/a
4 TRCN0000255491 TTTCAGCATTGAGAGTATTAT pLKO_005 971 CDS 100% 15.000 7.500 Y FOXD4L4 n/a
5 TRCN0000021031 CTTTCAGCATTGAGAGTATTA pLKO.1 970 CDS 100% 13.200 6.600 Y FOXD4L4 n/a
6 TRCN0000107796 TCTTTCAGCATTGAGAGTATT pLKO.1 969 CDS 100% 13.200 6.600 Y FOXD4L3 n/a
7 TRCN0000262397 TTCAGCATTGAGAGTATTATG pLKO_005 972 CDS 100% 13.200 6.600 Y FOXD4L5 n/a
8 TRCN0000255488 CCCAGGACATGTTCGACAATG pLKO_005 563 CDS 100% 10.800 5.400 Y FOXD4L4 n/a
9 TRCN0000262398 TAGTGGCCGCTTCCCATACTA pLKO_005 414 CDS 100% 5.625 2.813 Y FOXD4L5 n/a
10 TRCN0000255490 ACTCGTACATCGCGCTCATCA pLKO_005 332 CDS 100% 4.950 2.475 Y FOXD4L4 n/a
11 TRCN0000017866 CTCTTTCAGCATTGAGAGTAT pLKO.1 968 CDS 100% 4.950 2.475 Y FOXD4 n/a
12 TRCN0000174049 CTCTTTCAGCATTGAGAGTAT pLKO.1 968 CDS 100% 4.950 2.475 Y FOXD4 n/a
13 TRCN0000262396 CCGCTGCTGCTCGGACAATTT pLKO_005 1129 CDS 100% 4.400 2.200 Y FOXD4L5 n/a
14 TRCN0000418966 CATCCTCTTCGCTACCTACTG pLKO_005 796 CDS 100% 4.050 2.025 Y FOXD4L4 n/a
15 TRCN0000107902 CTACTCGTACATCGCGCTCAT pLKO.1 330 CDS 100% 4.050 2.025 Y FOXD4L3 n/a
16 TRCN0000282437 GCATCCTCTTCGCTACCTACT pLKO_005 795 CDS 100% 4.050 2.025 Y FOXD4L6 n/a
17 TRCN0000262395 TACTCGTACATCGCGCTCATC pLKO_005 331 CDS 100% 4.050 2.025 Y FOXD4L5 n/a
18 TRCN0000262819 TTTCAAGCGCCACCAACTGAC pLKO_005 609 CDS 100% 4.050 2.025 Y FOXD4L6 n/a
19 TRCN0000107903 CGACCATCAAGCCTGTTGCAT pLKO.1 1071 CDS 100% 3.000 1.500 Y FOXD4L3 n/a
20 TRCN0000107904 CATGTTCGACAATGGCAGCTT pLKO.1 570 CDS 100% 2.640 1.320 Y FOXD4L3 n/a
21 TRCN0000016765 GAAGATGAAGACGAGGTGGAA pLKO.1 100 CDS 100% 2.640 1.320 Y FOXD4L1 n/a
22 TRCN0000016766 CCGGCGTAGGAAGCGTTTCAA pLKO.1 594 CDS 100% 1.875 0.938 Y FOXD4L1 n/a
23 TRCN0000021032 CCAGCGACCATCAAGCCTGTT pLKO.1 1067 CDS 100% 1.350 0.675 Y FOXD4L4 n/a
24 TRCN0000017867 GCAGAACAGCATCCGCCACAA pLKO.1 456 CDS 100% 1.350 0.675 Y FOXD4 n/a
25 TRCN0000021030 GCTGAACGACTGCTTCGTTAA pLKO.1 483 CDS 100% 1.080 0.540 Y FOXD4L4 n/a
26 TRCN0000107798 CCGCATCCTCTTCGCTACCTA pLKO.1 793 CDS 100% 1.000 0.500 Y FOXD4L3 n/a
27 TRCN0000016764 CGCCTTCATTAGTGGCCGCTT pLKO.1 405 CDS 100% 0.720 0.360 Y FOXD4L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10191 pDONR223 100% 98.8% 98% None (many diffs) n/a
2 ccsbBroad304_10191 pLX_304 0% 98.8% 98% V5 (many diffs) n/a
3 TRCN0000469817 ACCTCCTTCAGGTTCAAAACTAGC pLX_317 27.3% 98.8% 98% V5 (many diffs) n/a
4 ccsbBroadEn_00574 pDONR223 100% 83.6% 77.3% None (many diffs) n/a
5 ccsbBroad304_00574 pLX_304 0% 83.6% 77.3% V5 (many diffs) n/a
6 TRCN0000476871 CCCACCCTAACGAGCTCGAATCCA pLX_317 25.3% 83.6% 77.3% V5 (many diffs) n/a
Download CSV