Transcript: Human NR_024362.1

Homo sapiens family with sequence similarity 86 member B3, pseudogene (FAM86B3P), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
FAM86B3P (286042)
Length:
1643
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024362.1
NBCI Gene record:
FAM86B3P (286042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 347 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
2 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 345 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
3 TRCN0000168609 GATGTTGTCATTGCAGCAGAT pLKO.1 858 3UTR 100% 4.050 2.025 Y EEF2KMT n/a
4 TRCN0000190450 GTTGTCATTGCAGCAGATGTA pLKO.1 861 3UTR 100% 4.950 2.475 Y Eef2kmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 57.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 54.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_09791 pDONR223 100% 54% None (many diffs) n/a
4 ccsbBroad304_09791 pLX_304 0% 54% V5 (many diffs) n/a
5 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 54% V5 (many diffs) n/a
6 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 54% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV