Transcript: Human NR_026540.1

Homo sapiens SLC25A51 pseudogene 1 (SLC25A51P1), non-coding RNA.

Source:
NCBI, updated 2019-05-10
Taxon:
Homo sapiens (human)
Gene:
SLC25A51P1 (442229)
Length:
1605
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026540.1
NBCI Gene record:
SLC25A51P1 (442229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230321 CATGGAATTGGAGAGTATTAT pLKO_005 1034 3UTR 100% 15.000 7.500 Y SLC25A51 n/a
2 TRCN0000060237 GCACTGAAATGTCATGGAATT pLKO.1 1022 3UTR 100% 0.000 0.000 Y SLC25A51 n/a
3 TRCN0000218030 GAAGGGATGGATTTCGAAATT pLKO_005 753 3UTR 100% 13.200 6.600 Y SLC25A51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09328 pDONR223 100% 51.7% None (many diffs) n/a
2 ccsbBroad304_09328 pLX_304 0% 51.7% V5 (many diffs) n/a
3 TRCN0000470593 TAGGAACGATCGATGTACGAGGCA pLX_317 38.3% 51.7% V5 (many diffs) n/a
4 ccsbBroadEn_09645 pDONR223 100% 51.1% None (many diffs) n/a
5 ccsbBroad304_09645 pLX_304 0% 51.1% V5 (many diffs) n/a
6 TRCN0000466448 TAGTGGCTGCGCGCGAACTGTACT pLX_317 39.4% 51.1% V5 (many diffs) n/a
7 ccsbBroadEn_10649 pDONR223 100% 26.2% None (many diffs) n/a
8 ccsbBroad304_10649 pLX_304 0% 26.2% V5 (many diffs) n/a
9 TRCN0000472625 TAGCACACACGCGCCGGTTGATAT pLX_317 100% 26.2% V5 (many diffs) n/a
10 ccsbBroadEn_14505 pDONR223 100% 12.7% None 1_538del;735_736delAT;746_1605del n/a
11 ccsbBroad304_14505 pLX_304 0% 12.7% V5 (not translated due to frame shift) 1_538del;735_736delAT;746_1605del n/a
12 TRCN0000479542 CCCATGTGCTCCACTGGGACTGCC pLX_317 100% 12.7% V5 (not translated due to prior stop codon) 1_538del;735_736delAT;746_1605del n/a
Download CSV