Transcript: Human NR_026541.1

Homo sapiens SLC25A51 pseudogene 4 (SLC25A51P4), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-05-13
Taxon:
Homo sapiens (human)
Gene:
SLC25A51P4 (494141)
Length:
2093
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026541.1
NBCI Gene record:
SLC25A51P4 (494141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230319 TTGGTCTGTATGAGGATTTAT pLKO_005 558 3UTR 100% 15.000 7.500 Y SLC25A51 n/a
2 TRCN0000134735 GTTTGGTCTGTATGAGGATTT pLKO.1 556 3UTR 100% 10.800 5.400 Y SLC25A52 n/a
3 TRCN0000060236 CCCATTCAGAAGGTCCTCTTT pLKO.1 410 3UTR 100% 4.950 2.475 Y SLC25A51 n/a
4 TRCN0000135539 GAATGGACTCAGCAATGTCTT pLKO.1 794 3UTR 100% 4.950 2.475 Y SLC25A52 n/a
5 TRCN0000138179 CAGGCTTTCAAGGCACTGAAA pLKO.1 723 3UTR 100% 0.495 0.248 Y SLC25A52 n/a
6 TRCN0000060237 GCACTGAAATGTCATGGAATT pLKO.1 735 3UTR 100% 0.000 0.000 Y SLC25A51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09645 pDONR223 100% 38.9% None (many diffs) n/a
2 ccsbBroad304_09645 pLX_304 0% 38.9% V5 (many diffs) n/a
3 TRCN0000466448 TAGTGGCTGCGCGCGAACTGTACT pLX_317 39.4% 38.9% V5 (many diffs) n/a
4 ccsbBroadEn_09328 pDONR223 100% 38.3% None (many diffs) n/a
5 ccsbBroad304_09328 pLX_304 0% 38.3% V5 (many diffs) n/a
6 TRCN0000470593 TAGGAACGATCGATGTACGAGGCA pLX_317 38.3% 38.3% V5 (many diffs) n/a
7 ccsbBroadEn_10649 pDONR223 100% 22% None 1_238del;411C>T;701_2093del n/a
8 ccsbBroad304_10649 pLX_304 0% 22% V5 1_238del;411C>T;701_2093del n/a
9 TRCN0000472625 TAGCACACACGCGCCGGTTGATAT pLX_317 100% 22% V5 1_238del;411C>T;701_2093del n/a
10 ccsbBroadEn_14505 pDONR223 100% 8.9% None (many diffs) n/a
11 ccsbBroad304_14505 pLX_304 0% 8.9% V5 (not translated due to frame shift) (many diffs) n/a
12 TRCN0000479542 CCCATGTGCTCCACTGGGACTGCC pLX_317 100% 8.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV