Transcript: Human NR_027622.1

Homo sapiens four and a half LIM domains 1 pseudogene (LOC100128164), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC100128164 (100128164)
Length:
6057
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027622.1
NBCI Gene record:
LOC100128164 (100128164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294456 CTCCAAGGAGGTGCACTATAA pLKO_005 3416 3UTR 100% 13.200 6.600 Y FHL1 n/a
2 TRCN0000117826 TGGTGGCCTATGAAGGACAAT pLKO.1 3974 3UTR 100% 4.950 2.475 Y FHL1 n/a
3 TRCN0000113523 AGCAACTGCAAGCAAGTCATT pLKO.1 3652 3UTR 100% 4.950 2.970 N Fhl1 n/a
4 TRCN0000326111 AGCAACTGCAAGCAAGTCATT pLKO_005 3652 3UTR 100% 4.950 2.970 N Fhl1 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2822 3UTR 100% 4.950 2.475 Y KAAG1 n/a
6 TRCN0000117824 CTGCCTGAAATGCTTTGACAA pLKO.1 3347 3UTR 100% 4.950 2.475 Y FHL1 n/a
7 TRCN0000286999 CTGCCTGAAATGCTTTGACAA pLKO_005 3347 3UTR 100% 4.950 2.475 Y FHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00567 pDONR223 100% 12.8% None (many diffs) n/a
2 ccsbBroad304_00567 pLX_304 0% 12.8% V5 (many diffs) n/a
3 TRCN0000470524 TCCCGGTGTGGCCGGAGATGCCTC pLX_317 38.4% 12.8% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1% V5 (many diffs) n/a
Download CSV