Transcript: Mouse NR_028143.1

Mus musculus leucine rich repeat containing 28 (Lrrc28), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Lrrc28 (67867)
Length:
2883
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028143.1
NBCI Gene record:
Lrrc28 (67867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_028143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179606 GCAGTACGTGTATGTGGATAA pLKO.1 648 3UTR 100% 10.800 15.120 N Lrrc28 n/a
2 TRCN0000179285 GCGTCATCTTCGATTAGCTAA pLKO.1 467 3UTR 100% 4.950 6.930 N Lrrc28 n/a
3 TRCN0000216071 CTCTGTTTACTGGTATGATTT pLKO.1 2180 3UTR 100% 13.200 9.240 N Lrrc28 n/a
4 TRCN0000217567 GGAAACCATCTTGCATCTTTG pLKO.1 598 3UTR 100% 10.800 7.560 N Lrrc28 n/a
5 TRCN0000216651 CAATGCCTTAGAGATCGTTTG pLKO.1 419 3UTR 100% 6.000 4.200 N Lrrc28 n/a
6 TRCN0000183474 GTACGTGTATGTGGATAACAA pLKO.1 651 3UTR 100% 5.625 3.938 N Lrrc28 n/a
7 TRCN0000179820 CCCATGTTTACCTTCGTCTAT pLKO.1 994 3UTR 100% 4.950 3.465 N Lrrc28 n/a
8 TRCN0000195923 CCTCTGGAAACTTCCTGTCTT pLKO.1 1724 3UTR 100% 4.950 3.465 N Lrrc28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04772 pDONR223 100% 29.5% None (many diffs) n/a
2 ccsbBroad304_04772 pLX_304 0% 29.5% V5 (many diffs) n/a
3 TRCN0000466194 TCCCGTCAACCGGTGAGCTGGTCA pLX_317 35.2% 29.5% V5 (many diffs) n/a
4 ccsbBroadEn_13098 pDONR223 100% 8.5% None (many diffs) n/a
5 ccsbBroad304_13098 pLX_304 0% 8.5% V5 (many diffs) n/a
6 TRCN0000468959 TCCTAGGGACCACCATATTTTTAG pLX_317 100% 8.5% V5 (many diffs) n/a
Download CSV