Transcript: Mouse NR_033144.1

Mus musculus RIKEN cDNA 4921524J17 gene (4921524J17Rik), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
4921524J17Rik (66714)
Length:
1498
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033144.1
NBCI Gene record:
4921524J17Rik (66714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179720 GATCTCGAAGTAACAGCCATT pLKO.1 277 3UTR 100% 4.050 5.670 N 4921524J17Rik n/a
2 TRCN0000217538 CAGTTGCCTTGGCAGAAATAA pLKO.1 430 3UTR 100% 15.000 10.500 N 4921524J17Rik n/a
3 TRCN0000264870 GAATGGAGAATTACGAATATA pLKO_005 990 3UTR 100% 15.000 10.500 N 4921524J17Rik n/a
4 TRCN0000264873 GTTAGGCGAGAGAAGATAAAT pLKO_005 222 3UTR 100% 15.000 10.500 N 4921524J17Rik n/a
5 TRCN0000264871 AGAAAGAGATCTCGAAGTAAC pLKO_005 270 3UTR 100% 10.800 7.560 N 4921524J17Rik n/a
6 TRCN0000216081 CACCATTAACAGATTGCATAT pLKO.1 924 3UTR 100% 10.800 7.560 N 4921524J17Rik n/a
7 TRCN0000134273 GTAACAGCCATTCAGATCATA pLKO.1 286 3UTR 100% 5.625 3.938 N C16orf87 n/a
8 TRCN0000135702 CGAAGTAACAGCCATTCAGAT pLKO.1 282 3UTR 100% 4.950 3.465 N C16orf87 n/a
9 TRCN0000135146 CAGATCATATCAGACGAGGAA pLKO.1 298 3UTR 100% 2.640 3.696 N C16orf87 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05574 pDONR223 100% 21.9% None (many diffs) n/a
2 ccsbBroad304_05574 pLX_304 0% 21.9% V5 (many diffs) n/a
3 TRCN0000492013 GATTTCCCTGGCAGTAGGAAGCGC pLX_317 91% 21.9% V5 (many diffs) n/a
Download CSV