Transcript: Human NR_033702.2

Homo sapiens myoneurin (MYNN), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MYNN (55892)
Length:
4839
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033702.2
NBCI Gene record:
MYNN (55892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419402 GACCATTTATCTGCGAATTAT pLKO_005 1458 3UTR 100% 15.000 21.000 N MYNN n/a
2 TRCN0000016330 CCTATCATGTCCGTAGGCATA pLKO.1 1260 3UTR 100% 4.050 5.670 N MYNN n/a
3 TRCN0000016331 CCAGTTTAAAGCTCATAGGAA pLKO.1 197 3UTR 100% 3.000 2.400 N MYNN n/a
4 TRCN0000431970 ATTTGAGTTGTGACCATTATT pLKO_005 1888 3UTR 100% 15.000 10.500 N MYNN n/a
5 TRCN0000016329 GTCTCCTACATCAGATACATT pLKO.1 1717 3UTR 100% 5.625 3.938 N MYNN n/a
6 TRCN0000016328 CCCAGTGACATCTTAGAGAAT pLKO.1 566 3UTR 100% 4.950 3.465 N MYNN n/a
7 TRCN0000016332 GCATCTGTTGAATTATTCCTA pLKO.1 587 3UTR 100% 3.000 2.100 N MYNN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08607 pDONR223 100% 34.1% None (many diffs) n/a
2 ccsbBroad304_08607 pLX_304 0% 34.1% V5 (many diffs) n/a
3 TRCN0000473910 CTTTCGTGTGTTCAGTATAAGCCT pLX_317 21.3% 34.1% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% .9% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% .9% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .9% V5 (many diffs) n/a
Download CSV