Transcript: Human NR_037702.1

Homo sapiens ring finger protein 7 (RNF7), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
RNF7 (9616)
Length:
2274
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037702.1
NBCI Gene record:
RNF7 (9616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295978 TCAGAAATTCTCTGCGATTAA pLKO_005 915 3UTR 100% 13.200 18.480 N RNF7 n/a
2 TRCN0000295934 TGCTTATGGTTGATCAGTTAA pLKO_005 1100 3UTR 100% 13.200 18.480 N RNF7 n/a
3 TRCN0000243750 CAAGTCGGGAGGCGACAAGAT pLKO_005 199 3UTR 100% 1.650 2.310 N LOC632465 n/a
4 TRCN0000038804 CCCAACTCTTACTCTTAATTT pLKO.1 1160 3UTR 100% 15.000 12.000 N RNF7 n/a
5 TRCN0000038807 GTCTTAGATGTCAAGCTGAAA pLKO.1 579 3UTR 100% 4.950 3.960 N RNF7 n/a
6 TRCN0000295935 ACAGCTTAGAAGTGCTATAAA pLKO_005 990 3UTR 100% 15.000 10.500 N RNF7 n/a
7 TRCN0000295933 GTAATCCAGTGCCCTACAAAG pLKO_005 791 3UTR 100% 10.800 7.560 N RNF7 n/a
8 TRCN0000239804 TGTGGGTGAAACAGAACAATC pLKO_005 669 3UTR 100% 10.800 7.560 N LOC639931 n/a
9 TRCN0000307365 ATGTCCCTGTGGGTGAAACAG pLKO_005 662 3UTR 100% 4.950 3.465 N Rnf7 n/a
10 TRCN0000239948 CATGTCCCTGTGGGTGAAACA pLKO_005 661 3UTR 100% 4.950 3.465 N Gm7075 n/a
11 TRCN0000038806 CCTGTGGGTGAAACAGAACAA pLKO.1 667 3UTR 100% 4.950 3.465 N RNF7 n/a
12 TRCN0000298777 CCTGTGGGTGAAACAGAACAA pLKO_005 667 3UTR 100% 4.950 3.465 N RNF7 n/a
13 TRCN0000038805 CGACAAGATGTTCTCCCTCAA pLKO.1 211 3UTR 100% 4.050 2.835 N RNF7 n/a
14 TRCN0000038808 CCTCAAGAAGTGGAACGCGGT pLKO.1 226 3UTR 100% 0.180 0.126 N RNF7 n/a
15 TRCN0000239947 TGGTCCAAAGAATCGGCAAAT pLKO_005 717 3UTR 100% 10.800 6.480 N Gm7075 n/a
16 TRCN0000243749 TCAAGAAGTGGAACGCGGTAG pLKO_005 228 3UTR 100% 2.250 1.575 N LOC632465 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1696 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1696 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02212 pDONR223 100% 14.9% None 1_133del;309_572del;737_2274del n/a
2 ccsbBroad304_02212 pLX_304 0% 14.9% V5 1_133del;309_572del;737_2274del n/a
3 TRCN0000469857 AGATTTCGTTCTTTTGATTCATAA pLX_317 100% 14.9% V5 1_133del;309_572del;737_2274del n/a
4 ccsbBroadEn_07450 pDONR223 100% 14.8% None (many diffs) n/a
5 ccsbBroad304_07450 pLX_304 0% 14.8% V5 (many diffs) n/a
6 ccsbBroadEn_13781 pDONR223 100% 10.6% None (many diffs) n/a
7 ccsbBroad304_13781 pLX_304 0% 10.6% V5 (many diffs) n/a
8 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 10.6% V5 (many diffs) n/a
9 ccsbBroadEn_11616 pDONR223 100% 7.5% None (many diffs) n/a
10 ccsbBroad304_11616 pLX_304 0% 7.5% V5 (many diffs) n/a
11 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 7.5% V5 (many diffs) n/a
12 ccsbBroadEn_15487 pDONR223 0% 7.1% None (many diffs) n/a
13 ccsbBroad304_15487 pLX_304 0% 7.1% V5 (many diffs) n/a
14 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 7.1% V5 (many diffs) n/a
15 ccsbBroadEn_10261 pDONR223 100% 2.8% None (many diffs) n/a
16 ccsbBroad304_10261 pLX_304 0% 2.8% V5 (many diffs) n/a
17 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.8% V5 (many diffs) n/a
Download CSV