Transcript: Human NR_038161.2

Homo sapiens mitochondrial ribosomal protein L42 (MRPL42), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
MRPL42 (28977)
Length:
15662
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038161.2
NBCI Gene record:
MRPL42 (28977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231835 CCTCTACCAGATGACTATAAT pLKO_005 352 3UTR 100% 15.000 21.000 N MRPL42 n/a
2 TRCN0000145025 GAAGGACCTATGATAGAACAA pLKO.1 553 3UTR 100% 4.950 6.930 N MRPL42 n/a
3 TRCN0000142099 GCCAAACTATCAGGCTCCAAA pLKO.1 1479 3UTR 100% 4.950 3.960 N MRPL42 n/a
4 TRCN0000122081 CCCTTCCATCAATTCTTATTA pLKO.1 1372 3UTR 100% 15.000 10.500 N MRPL42 n/a
5 TRCN0000231838 CAAGCATTGTTAGTAGTATAA pLKO_005 1183 3UTR 100% 13.200 9.240 N MRPL42 n/a
6 TRCN0000369726 TATGTGCGGTCTCCAATTTAG pLKO_005 886 3UTR 100% 13.200 9.240 N MRPL42 n/a
7 TRCN0000369725 TTCAACTGATAGTAGGTTTAT pLKO_005 1083 3UTR 100% 13.200 9.240 N MRPL42 n/a
8 TRCN0000142182 GCCAGTGAAGTGTGAGGAATA pLKO.1 1956 3UTR 100% 10.800 7.560 N MRPL42 n/a
9 TRCN0000122169 GACCTATGATAGAACAACTTA pLKO.1 557 3UTR 100% 5.625 3.938 N MRPL42 n/a
10 TRCN0000142033 GAGCTTGCTCTGACTTCTGAT pLKO.1 382 3UTR 100% 4.950 3.465 N MRPL42 n/a
11 TRCN0000121805 GTCAAAGAGAACTATCTTGAA pLKO.1 165 3UTR 100% 4.950 3.465 N MRPL42 n/a
12 TRCN0000280861 GTCAAAGAGAACTATCTTGAA pLKO_005 165 3UTR 100% 4.950 3.465 N MRPL42 n/a
13 TRCN0000144150 CAGATGTCGTAAGAATCTGAA pLKO.1 630 3UTR 100% 0.495 0.347 N MRPL42 n/a
14 TRCN0000231837 CCAGATCCTGTGCATAATAAT pLKO_005 472 3UTR 100% 15.000 9.000 N MRPL42 n/a
15 TRCN0000231836 ACTTCTGATGGCAGGACAATA pLKO_005 394 3UTR 100% 13.200 7.920 N MRPL42 n/a
16 TRCN0000231834 TTGTCATAAATCTACGTATTC pLKO_005 330 3UTR 100% 10.800 6.480 N MRPL42 n/a
17 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 13551 3UTR 100% 10.800 5.400 Y MRPS16 n/a
18 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7297 3UTR 100% 4.950 2.475 Y CFLAR n/a
19 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7297 3UTR 100% 4.950 2.475 Y C19orf31 n/a
20 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3773 3UTR 100% 4.950 2.475 Y n/a
21 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 8412 3UTR 100% 4.050 2.025 Y P3H4 n/a
22 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 8412 3UTR 100% 4.050 2.025 Y ORAI2 n/a
23 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 8412 3UTR 100% 4.050 2.025 Y P3H4 n/a
24 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 11638 3UTR 100% 13.200 6.600 Y LIAS n/a
25 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 13551 3UTR 100% 10.800 5.400 Y CD3EAP n/a
26 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7650 3UTR 100% 5.625 2.813 Y KLHL30 n/a
27 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7295 3UTR 100% 4.950 2.475 Y ERN2 n/a
28 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7295 3UTR 100% 4.950 2.475 Y P3H4 n/a
29 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7295 3UTR 100% 4.950 2.475 Y P3H4 n/a
30 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7650 3UTR 100% 5.625 2.813 Y EID2B n/a
31 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3809 3UTR 100% 4.950 2.475 Y LOC387873 n/a
32 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 11804 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03052 pDONR223 100% 2.7% None 1_135del;206_310del;667_15662del n/a
2 ccsbBroad304_03052 pLX_304 0% 2.7% V5 1_135del;206_310del;667_15662del n/a
3 ccsbBroadEn_12783 pDONR223 100% 1.2% None (many diffs) n/a
4 ccsbBroad304_12783 pLX_304 0% 1.2% V5 (many diffs) n/a
5 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 1.2% V5 (many diffs) n/a
6 ccsbBroadEn_10261 pDONR223 100% .4% None (many diffs) n/a
7 ccsbBroad304_10261 pLX_304 0% .4% V5 (many diffs) n/a
8 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .4% V5 (many diffs) n/a
Download CSV