Transcript: Human NR_102318.1

Homo sapiens actin related protein 3 (ACTR3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
ACTR3 (10096)
Length:
5583
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102318.1
NBCI Gene record:
ACTR3 (10096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029379 CCTCCATTGAATACTCCAGAA pLKO.1 564 3UTR 100% 4.050 5.670 N ACTR3 n/a
2 TRCN0000343279 CCTCCATTGAATACTCCAGAA pLKO_005 564 3UTR 100% 4.050 5.670 N ACTR3 n/a
3 TRCN0000380403 GTAACACCAAACATGATTATA pLKO_005 1588 3UTR 100% 15.000 12.000 N ACTR3 n/a
4 TRCN0000029382 CGTCCTCTCTACAAGAATATT pLKO.1 1158 3UTR 100% 15.000 10.500 N ACTR3 n/a
5 TRCN0000343226 CGTCCTCTCTACAAGAATATT pLKO_005 1158 3UTR 100% 15.000 10.500 N ACTR3 n/a
6 TRCN0000029381 GCCATGGTATAGTTGAAGATT pLKO.1 457 3UTR 100% 5.625 3.938 N ACTR3 n/a
7 TRCN0000343278 GCCATGGTATAGTTGAAGATT pLKO_005 457 3UTR 100% 5.625 3.938 N ACTR3 n/a
8 TRCN0000029380 GCTGAAATTAAGTGAGGAATT pLKO.1 1259 3UTR 100% 0.000 0.000 N ACTR3 n/a
9 TRCN0000352820 GCTGAAATTAAGTGAGGAATT pLKO_005 1259 3UTR 100% 0.000 0.000 N ACTR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02313 pDONR223 100% 19.7% None 1_346del;446_447ins125;1476_5583del n/a
2 ccsbBroad304_02313 pLX_304 0% 19.7% V5 1_346del;446_447ins125;1476_5583del n/a
3 TRCN0000467535 CCCCTGACTGGTTGATGGTACCGA pLX_317 28.8% 19.7% V5 1_346del;446_447ins125;1476_5583del n/a
Download CSV