Transcript: Mouse NR_131896.1

Mus musculus CDK5 regulatory subunit associated protein 1-like 1 (Cdkal1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cdkal1 (68916)
Length:
3398
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131896.1
NBCI Gene record:
Cdkal1 (68916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340532 TAACGATTGCTACGGATATTA pLKO_005 1219 3UTR 100% 15.000 21.000 N Cdkal1 n/a
2 TRCN0000173270 CCTAAAGTACGAAGGCGGAAT pLKO.1 261 3UTR 100% 4.050 5.670 N Cdkal1 n/a
3 TRCN0000175184 CCACTTTAGAAACTCAATCAA pLKO.1 503 3UTR 100% 5.625 4.500 N Cdkal1 n/a
4 TRCN0000340531 ATGACAAATCCACCATATATT pLKO_005 1026 3UTR 100% 15.000 10.500 N Cdkal1 n/a
5 TRCN0000217277 CTTGCTGCCTATGGCTATAAA pLKO.1 411 3UTR 100% 15.000 10.500 N Cdkal1 n/a
6 TRCN0000364367 ACTTGTTGAAGAGTACAAATT pLKO_005 1289 3UTR 100% 13.200 9.240 N CDKAL1 n/a
7 TRCN0000194337 CCACCAAGTGACAGCACTATT pLKO.1 312 3UTR 100% 13.200 9.240 N Cdkal1 n/a
8 TRCN0000174642 GCATGACAAATCCACCATATA pLKO.1 1024 3UTR 100% 13.200 9.240 N Cdkal1 n/a
9 TRCN0000340530 GCTTGCTGCCTATGGCTATAA pLKO_005 410 3UTR 100% 13.200 7.920 N Cdkal1 n/a
10 TRCN0000256114 GACCACTTTAGAAACTCAATT pLKO_005 501 3UTR 100% 13.200 9.240 N CDKAL1 n/a
11 TRCN0000070352 CCTGTGGAAGTTGGTGGAAAT pLKO.1 974 3UTR 100% 10.800 5.400 Y Slc5a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03477 pDONR223 100% 43.6% None (many diffs) n/a
2 ccsbBroad304_03477 pLX_304 0% 43.6% V5 (many diffs) n/a
3 TRCN0000475115 ACTTGGTCCAGACCCATGATCACA pLX_317 30.9% 43.6% V5 (many diffs) n/a
4 ccsbBroadEn_14174 pDONR223 100% 7.2% None (many diffs) n/a
5 ccsbBroad304_14174 pLX_304 0% 7.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000468296 GAAAAGTAAGGACTTAGACTTGGT pLX_317 100% 7.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV