Transcript: Human NR_138091.1

Homo sapiens ankyrin repeat domain 20 family member A9, pseudogene (ANKRD20A9P), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
ANKRD20A9P (284232)
Length:
3318
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138091.1
NBCI Gene record:
ANKRD20A9P (284232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255623 TGGACTGTGTAGAACAAATAA pLKO_005 3106 3UTR 100% 15.000 7.500 Y ANKRD20A20P n/a
2 TRCN0000419116 ATATCCAAAGAGGCTTTATTG pLKO_005 1853 3UTR 100% 13.200 6.600 Y ANKRD20A1 n/a
3 TRCN0000167112 CACAGGTCAAAGAAGGAAATA pLKO.1 655 3UTR 100% 13.200 6.600 Y ANKRD20A1 n/a
4 TRCN0000434616 CATCAGAAAGAGGATCATAAA pLKO_005 1819 3UTR 100% 13.200 6.600 Y ANKRD20A1 n/a
5 TRCN0000128130 CGGTATCAACAAGAGCTTAAT pLKO.1 1222 3UTR 100% 13.200 6.600 Y ANKRD20A2 n/a
6 TRCN0000423507 GGTATCAACAAGAGCTTAATG pLKO_005 1223 3UTR 100% 13.200 6.600 Y ANKRD20A1 n/a
7 TRCN0000262906 TCATCAGAAAGAGGATCATAA pLKO_005 1818 3UTR 100% 13.200 6.600 Y ANKRD20A4 n/a
8 TRCN0000127485 CCACAGGTCAAAGAAGGAAAT pLKO.1 654 3UTR 100% 10.800 5.400 Y ANKRD20A2 n/a
9 TRCN0000262905 TGTGAAAGGAGCAGTACAAAG pLKO_005 542 3UTR 100% 10.800 5.400 Y ANKRD20A4 n/a
10 TRCN0000155962 CTGTGAAAGGAGCAGTACAAA pLKO.1 541 3UTR 100% 5.625 2.813 Y ANKRD20A11P n/a
11 TRCN0000154355 CTTCAGAGGAAGAGCAACAAA pLKO.1 607 3UTR 100% 5.625 2.813 Y ANKRD20A11P n/a
12 TRCN0000156157 CCTAGCACTGAAATGGAAGAT pLKO.1 516 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
13 TRCN0000158171 CCTTGAAGCCTAGCACTGAAA pLKO.1 508 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
14 TRCN0000128015 GCTGAGAATACAAGGCTCAAT pLKO.1 1252 3UTR 100% 4.950 2.475 Y ANKRD20A2 n/a
15 TRCN0000136726 GCTGAGAATACAAGGCTCAAT pLKO.1 1252 3UTR 100% 4.950 2.475 Y ANKRD20A3 n/a
16 TRCN0000156881 GCTGTGAAAGGAGCAGTACAA pLKO.1 540 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
17 TRCN0000156610 GCTTCAGAGGAAGAGCAACAA pLKO.1 606 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
18 TRCN0000137846 GTGTGGATTCATTGCCTGCAT pLKO.1 348 3UTR 100% 2.640 1.320 Y ANKRD20A3 n/a
19 TRCN0000134343 GCATGATAGATGCACCTTAAA pLKO.1 813 3UTR 100% 13.200 6.600 Y ANKRD20A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13700 pDONR223 100% 48.2% None (many diffs) n/a
2 ccsbBroad304_13700 pLX_304 0% 48.2% V5 (many diffs) n/a
3 TRCN0000476704 CAATTCCTCTTAAGATTAAATCAT pLX_317 15.4% 48.2% V5 (many diffs) n/a
4 ccsbBroadEn_13631 pDONR223 100% 4.5% None (many diffs) n/a
5 ccsbBroad304_13631 pLX_304 0% 4.5% V5 (many diffs) n/a
6 TRCN0000477773 GCACCGACAGTTTAATGATTATCA pLX_317 100% 4.5% V5 (many diffs) n/a
Download CSV