Transcript: Human NR_146580.1

Homo sapiens family with sequence similarity 239 member A (FAM239A), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
FAM239A (101930105)
Length:
4986
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146580.1
NBCI Gene record:
FAM239A (101930105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082591 CGCCTCTTCAACGCGCACGCT pLKO.1 9 3UTR 100% 0.000 0.000 N LOC389907 n/a
2 TRCN0000082363 GCCGACTGTAACATGTTTCAT pLKO.1 937 3UTR 100% 5.625 2.813 Y LOC389906 n/a
3 TRCN0000082365 ACCGTGGGAAAGCAACTAGAA pLKO.1 581 3UTR 100% 4.950 2.475 Y LOC389906 n/a
4 TRCN0000082592 CCTTCAAGACTTCGACACGCT pLKO.1 556 3UTR 100% 0.660 0.330 Y LOC389907 n/a
5 TRCN0000082590 CCGCCTGCCAACCGCCTTCAA pLKO.1 542 3UTR 100% 0.000 0.000 Y LOC389907 n/a
6 TRCN0000199604 GAAGGCGCATTGGCGTCTTGC pLKO.1 263 3UTR 100% 0.000 0.000 Y LOC389906 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4081 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1538 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4081 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 3.8% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 3.8% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.8% V5 (many diffs) n/a
Download CSV