Transcript: Human NR_147040.2

Homo sapiens killer cell lectin like receptor D1 (KLRD1), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
KLRD1 (3824)
Length:
15414
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147040.2
NBCI Gene record:
KLRD1 (3824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416718 AGAACTGCATAGCGTATAATC pLKO_005 508 3UTR 100% 13.200 18.480 N KLRD1 n/a
2 TRCN0000057410 CCTTAGGGATAATATGCCTTT pLKO.1 252 3UTR 100% 4.050 5.670 N KLRD1 n/a
3 TRCN0000421350 GAAATTCGTTCACCTACATTT pLKO_005 769 3UTR 100% 13.200 9.240 N KLRD1 n/a
4 TRCN0000434614 GACCCAACATTACTAACAATG pLKO_005 633 3UTR 100% 10.800 7.560 N KLRD1 n/a
5 TRCN0000057411 CCAGTATCTATTTCCATCATT pLKO.1 470 3UTR 100% 5.625 3.938 N KLRD1 n/a
6 TRCN0000057408 CCCAACATAGAACTCCAGAAA pLKO.1 350 3UTR 100% 4.950 3.465 N KLRD1 n/a
7 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 9922 3UTR 100% 13.200 6.600 Y LRRC74B n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1739 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 2790 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
10 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 2790 3UTR 100% 4.950 2.475 Y SPC25 n/a
11 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2783 3UTR 100% 4.950 2.475 Y SPC25 n/a
12 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 2622 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1700 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1700 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1700 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 4444 3UTR 100% 4.050 2.025 Y LOC441087 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4390 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5931 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1736 3UTR 100% 4.950 2.475 Y LOC339059 n/a
20 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 2622 3UTR 100% 4.950 2.475 Y OR11A1 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5931 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00911 pDONR223 100% 2.4% None (many diffs) n/a
2 ccsbBroad304_00911 pLX_304 0% 2.4% V5 (many diffs) n/a
3 ccsbBroadEn_12783 pDONR223 100% 1.2% None (many diffs) n/a
4 ccsbBroad304_12783 pLX_304 0% 1.2% V5 (many diffs) n/a
5 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 1.2% V5 (many diffs) n/a
6 ccsbBroadEn_11447 pDONR223 100% .8% None (many diffs) n/a
7 ccsbBroad304_11447 pLX_304 0% .8% V5 (many diffs) n/a
8 TRCN0000467425 CGCATGCCTGCGATCATAACATCA pLX_317 100% .8% V5 (many diffs) n/a
9 ccsbBroadEn_10261 pDONR223 100% .4% None (many diffs) n/a
10 ccsbBroad304_10261 pLX_304 0% .4% V5 (many diffs) n/a
11 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .4% V5 (many diffs) n/a
Download CSV