Transcript: Human NR_148878.1

Homo sapiens family with sequence similarity 86 member B2 (FAM86B2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
FAM86B2 (653333)
Length:
1268
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148878.1
NBCI Gene record:
FAM86B2 (653333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444970 CTGAGCTGCTGCGGGATATTT pLKO_005 184 3UTR 100% 15.000 7.500 Y EEF2KMT n/a
2 TRCN0000447299 TCTGAGCTGCTGCGGGATATT pLKO_005 183 3UTR 100% 13.200 6.600 Y FAM86C1 n/a
3 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 268 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
4 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 266 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
5 TRCN0000130496 GACCAGAAACTGTTTCCCTAT pLKO.1 718 3UTR 100% 4.050 2.025 Y FAM86B1 n/a
6 TRCN0000131177 GCCTTCATTAACAGACGTGCT pLKO.1 516 3UTR 100% 2.160 1.080 Y FAM86B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 44.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_09791 pDONR223 100% 40.2% None (many diffs) n/a
4 ccsbBroad304_09791 pLX_304 0% 40.2% V5 (many diffs) n/a
5 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 40.2% V5 (many diffs) n/a
6 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 40.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_03547 pDONR223 100% 24.6% None (many diffs) n/a
8 ccsbBroad304_03547 pLX_304 0% 24.6% V5 (many diffs) n/a
9 TRCN0000473048 AGTGCATTTCATCTCTGTAGCAAC pLX_317 92.4% 24.6% V5 (many diffs) n/a
Download CSV