Transcript: Mouse NR_160734.1

Mus musculus protocadherin gamma subfamily B, 8 (Pcdhgb8), transcript variant 1, non-coding, non-coding RNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Pcdhgb8 (93705)
Length:
3234
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160734.1
NBCI Gene record:
Pcdhgb8 (93705)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_160734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094921 CGTGGTGATAGAAGATATAAA pLKO.1 441 3UTR 100% 15.000 21.000 N Pcdhgb8 n/a
2 TRCN0000094920 GCGTGGTGATAGAAGATATAA pLKO.1 440 3UTR 100% 15.000 21.000 N Pcdhgb8 n/a
3 TRCN0000094922 CCTTAGAGTTATTGCAGAGAA pLKO.1 276 3UTR 100% 4.950 3.465 N Pcdhgb8 n/a
4 TRCN0000094923 GCCAGCAATTACTATAAGCTT pLKO.1 1273 3UTR 100% 3.000 2.100 N Pcdhgb8 n/a
5 TRCN0000094769 CCTATTCAATCAGTGATTGTA pLKO.1 3096 3UTR 100% 5.625 2.813 Y Pcdhgc4 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3161 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01151 pDONR223 100% 11.2% None (many diffs) n/a
2 ccsbBroad304_01151 pLX_304 0% 11.2% V5 (many diffs) n/a
3 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 11.2% V5 (many diffs) n/a
4 ccsbBroadEn_11019 pDONR223 100% 5% None (many diffs) n/a
5 ccsbBroad304_11019 pLX_304 0% 5% V5 (many diffs) n/a
Download CSV