Transcript: Human NM_001039709.1

Homo sapiens CBFA2/RUNX1 partner transcriptional co-repressor 2 (CBFA2T2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CBFA2T2 (9139)
Length:
7449
CDS:
337..2064

Additional Resources:

NCBI RefSeq record:
NM_001039709.1
NBCI Gene record:
CBFA2T2 (9139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013367 GCGCTGAATTGCATTATGGAA pLKO.1 1309 CDS 100% 3.000 4.200 N CBFA2T2 n/a
2 TRCN0000218645 ATTACACCTTAGAGGATATTG pLKO_005 1127 CDS 100% 13.200 10.560 N CBFA2T2 n/a
3 TRCN0000013366 GCAAGTTGAAACGCTTTCTTA pLKO.1 599 CDS 100% 5.625 4.500 N CBFA2T2 n/a
4 TRCN0000013365 GCACGAATGGAGCAAACCATA pLKO.1 1675 CDS 100% 4.950 3.960 N CBFA2T2 n/a
5 TRCN0000230332 CATAGTTACAGGTCATTATAT pLKO_005 3163 3UTR 100% 15.000 10.500 N CBFA2T2 n/a
6 TRCN0000230331 CACCACAGTCTTGGTCTAAAT pLKO_005 1210 CDS 100% 13.200 9.240 N CBFA2T2 n/a
7 TRCN0000230330 GCATCGAGAAGTTCGTGATAG pLKO_005 1188 CDS 100% 10.800 7.560 N CBFA2T2 n/a
8 TRCN0000257110 TCTTGACCATGCGCTGAATTG pLKO_005 1299 CDS 100% 10.800 7.560 N CBFA2T2 n/a
9 TRCN0000013363 CCCACATTCTTCCCTGTCTTT pLKO.1 3384 3UTR 100% 4.950 3.465 N CBFA2T2 n/a
10 TRCN0000013364 CCCAACAAGATGCTAGAGCAT pLKO.1 1171 CDS 100% 2.640 1.848 N CBFA2T2 n/a
11 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 4956 3UTR 100% 10.800 5.400 Y LOC388949 n/a
12 TRCN0000139739 CCTTCTGAGTAGCTGGGATTA pLKO.1 4822 3UTR 100% 10.800 5.400 Y INAVA n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4089 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3606 3UTR 100% 4.950 2.475 Y n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4086 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11342 pDONR223 100% 93.5% 93.6% None 0_1ins117;753C>T n/a
2 ccsbBroad304_11342 pLX_304 0% 93.5% 93.6% V5 0_1ins117;753C>T n/a
3 TRCN0000467640 GGCTCATATTGGCAGGAGAAGAAG pLX_317 23.9% 93.5% 93.6% V5 0_1ins117;753C>T n/a
4 ccsbBroadEn_11343 pDONR223 100% 40.3% 35.4% None (many diffs) n/a
5 ccsbBroad304_11343 pLX_304 0% 40.3% 35.4% V5 (many diffs) n/a
6 TRCN0000467899 TTTTCATGACACTCACTGATGGGC pLX_317 32% 40.3% 35.4% V5 (many diffs) n/a
Download CSV