Transcript: Human NM_014299.2

Homo sapiens bromodomain containing 4 (BRD4), transcript variant short, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
BRD4 (23476)
Length:
4635
CDS:
223..2391

Additional Resources:

NCBI RefSeq record:
NM_014299.2
NBCI Gene record:
BRD4 (23476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199427 CAGTGACAGTTCGACTGATGA pLKO.1 1707 CDS 100% 4.950 6.930 N BRD4 n/a
2 TRCN0000318773 CAGTGACAGTTCGACTGATGA pLKO_005 1707 CDS 100% 4.950 6.930 N BRD4 n/a
3 TRCN0000199459 GCCTATGTCCTATGAGGAGAA pLKO.1 2046 CDS 100% 4.050 5.670 N BRD4 n/a
4 TRCN0000349783 TGAACCTCCCTGATTACTATA pLKO_005 497 CDS 100% 13.200 10.560 N Brd4 n/a
5 TRCN0000382028 TGAACCTCCCTGATTACTATA pLKO_005 497 CDS 100% 13.200 10.560 N BRD4 n/a
6 TRCN0000021426 CGTCCGATTGATGTTCTCCAA pLKO.1 1485 CDS 100% 2.640 2.112 N BRD4 n/a
7 TRCN0000318836 CGTCCGATTGATGTTCTCCAA pLKO_005 1485 CDS 100% 2.640 2.112 N BRD4 n/a
8 TRCN0000349782 ATTGGACACGGACTCTTAATA pLKO_005 2394 3UTR 100% 15.000 10.500 N Brd4 n/a
9 TRCN0000380416 ATGAGCACAATCAAGTCTAAA pLKO_005 1420 CDS 100% 13.200 9.240 N BRD4 n/a
10 TRCN0000195245 CCTATGGATATGGGAACAATA pLKO.1 532 CDS 100% 13.200 9.240 N BRD4 n/a
11 TRCN0000199674 GCATCCTCAAGGAGATGTTTG pLKO.1 1298 CDS 100% 10.800 7.560 N BRD4 n/a
12 TRCN0000088479 CCTCCCTGATTACTATAAGAT pLKO.1 501 CDS 100% 5.625 3.938 N Brd4 n/a
13 TRCN0000021425 CCCTGATTACTATAAGATCAT pLKO.1 504 CDS 100% 4.950 3.465 N BRD4 n/a
14 TRCN0000021427 CCTGGAGATGACATAGTCTTA pLKO.1 646 CDS 100% 4.950 3.465 N BRD4 n/a
15 TRCN0000318771 CCTGGAGATGACATAGTCTTA pLKO_005 646 CDS 100% 4.950 3.465 N BRD4 n/a
16 TRCN0000088478 GACTCCATCAAGTTATGGAAT pLKO.1 2488 3UTR 100% 0.495 0.347 N Brd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014299.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15013 pDONR223 71.9% 99.7% 36.2% None (many diffs) n/a
2 ccsbBroad304_15013 pLX_304 26.9% 99.7% 36.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491254 CTCAGTAGTCTGCAGGTTTCGGTT pLX_317 11.4% 99.7% 36.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11738 pDONR223 100% 90.8% 90.8% None 2159_2159delGinsCT;2161C>T;2166_2166delCins216 n/a
5 ccsbBroad304_11738 pLX_304 0% 90.8% 90.8% V5 2159_2159delGinsCT;2161C>T;2166_2166delCins216 n/a
6 TRCN0000477053 TCTAGTTTCTTACTTTTTGCCGAC pLX_317 9.5% 90.8% 90.8% V5 2159_2159delGinsCT;2161C>T;2166_2166delCins216 n/a
7 TRCN0000487806 ATCGTTGCGGCTGACGACGATGAT pLX_317 12.2% 90.8% 90.8% V5 (not translated due to prior stop codon) 2159_2159delGinsCT;2161C>T;2166_2166delCins216 n/a
Download CSV