Transcript: Mouse NM_010513.2

Mus musculus insulin-like growth factor I receptor (Igf1r), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Igf1r (16001)
Length:
11978
CDS:
603..4712

Additional Resources:

NCBI RefSeq record:
NM_010513.2
NBCI Gene record:
Igf1r (16001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321972 CGGTAGCTGACACCTACAATA pLKO_005 2878 CDS 100% 13.200 18.480 N Igf1r n/a
2 TRCN0000023489 GCGGTGTCCAATAACTACATT pLKO.1 1089 CDS 100% 5.625 7.875 N Igf1r n/a
3 TRCN0000121133 GCGGTGTCCAATAACTACATT pLKO.1 1089 CDS 100% 5.625 7.875 N IGF1R n/a
4 TRCN0000023490 GCAGAATAATCTAGTCCTCAT pLKO.1 3902 CDS 100% 4.050 5.670 N Igf1r n/a
5 TRCN0000023492 CAATGGTAACTTGAGTTACTA pLKO.1 2516 CDS 100% 0.563 0.788 N Igf1r n/a
6 TRCN0000023493 CCAACGAGCAAGTTCTTCGTT pLKO.1 4258 CDS 100% 0.300 0.420 N Igf1r n/a
7 TRCN0000321978 CCAACGAGCAAGTTCTTCGTT pLKO_005 4258 CDS 100% 0.300 0.420 N Igf1r n/a
8 TRCN0000023491 CGGAAAGATGTACTTTGCTTT pLKO.1 1934 CDS 100% 4.950 3.960 N Igf1r n/a
9 TRCN0000350660 AGCTGTGTGTCTCCGAAATTT pLKO_005 1963 CDS 100% 15.000 10.500 N Igf1r n/a
10 TRCN0000321979 AGCAGGTTGTAACAATCTATT pLKO_005 4790 3UTR 100% 13.200 9.240 N Igf1r n/a
11 TRCN0000199517 GCGCATGTGCTGGCAGTATAA pLKO.1 4343 CDS 100% 13.200 9.240 N IGF1R n/a
12 TRCN0000321981 GGCCAAACTCAACCGTCTAAA pLKO_005 3275 CDS 100% 13.200 9.240 N Igf1r n/a
13 TRCN0000121195 GTCTTCCATAGAAAGAGAAAT pLKO.1 3474 CDS 100% 13.200 9.240 N IGF1R n/a
14 TRCN0000121135 GAGACAGAGTACCCTTTCTTT pLKO.1 2919 CDS 100% 5.625 3.938 N IGF1R n/a
15 TRCN0000121300 CATCAACAATGAGTACAACTA pLKO.1 1190 CDS 100% 4.950 3.465 N IGF1R n/a
16 TRCN0000039675 GCCGAAGATTTCACAGTCAAA pLKO.1 4038 CDS 100% 4.950 3.465 N IGF1R n/a
17 TRCN0000121193 CTTCGAGATGACCAATCTCAA pLKO.1 959 CDS 100% 0.495 0.347 N IGF1R n/a
18 TRCN0000121299 CTTCTACTACAGCGAGGAGAA pLKO.1 4442 CDS 100% 4.050 2.430 N IGF1R n/a
19 TRCN0000000422 CCTTAACTGACATGGGCCTTT pLKO.1 4946 3UTR 100% 4.050 5.670 N IGF1R n/a
20 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6548 3UTR 100% 4.950 2.475 Y KAAG1 n/a
21 TRCN0000195002 CAACACTTAATAGCAACAGAG pLKO.1 4981 3UTR 100% 4.050 3.240 N IGF1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14671 pDONR223 0% 89.4% 95.9% None (many diffs) n/a
2 ccsbBroad304_14671 pLX_304 0% 89.4% 95.9% V5 (many diffs) n/a
3 TRCN0000473406 AAAATCAGCCCATACACAGGGTTC pLX_317 10.2% 89.4% 95.9% V5 (many diffs) n/a
4 TRCN0000489071 TCACACATTATGCGGGCCCCCCCC pLX_317 7% 89.4% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489368 CCGATGCCTGTCGCCGTCTGGTGA pLX_317 8.2% 89.4% 95.9% V5 (many diffs) n/a
6 TRCN0000489182 GGGCACACGGTCTCTGTGCCATAC pLX_317 33.6% 25.1% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV