Transcript: Mouse NM_025696.3

Mus musculus sortilin-related VPS10 domain containing receptor 3 (Sorcs3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sorcs3 (66673)
Length:
5634
CDS:
156..3815

Additional Resources:

NCBI RefSeq record:
NM_025696.3
NBCI Gene record:
Sorcs3 (66673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175342 CGAACTCTCCTATACGGATAT pLKO.1 1892 CDS 100% 10.800 15.120 N Sorcs3 n/a
2 TRCN0000215831 CTAATTGGATTTCGTGGATAT pLKO.1 4788 3UTR 100% 10.800 15.120 N Sorcs3 n/a
3 TRCN0000173803 CCGGAGGATTGTATCCAACAA pLKO.1 2525 CDS 100% 4.950 6.930 N Sorcs3 n/a
4 TRCN0000215337 CACTATTTAATGCGCTTAATC pLKO.1 3394 CDS 100% 13.200 10.560 N Sorcs3 n/a
5 TRCN0000215775 CAAACAAAGATCTAGTCTTTA pLKO.1 4969 3UTR 100% 1.320 1.056 N Sorcs3 n/a
6 TRCN0000174913 GTGTTTCTGATCTACAAGTTT pLKO.1 3564 CDS 100% 5.625 3.938 N Sorcs3 n/a
7 TRCN0000193977 GCTCTTATCGTTCTCTCCAAA pLKO.1 3155 CDS 100% 4.950 3.465 N Sorcs3 n/a
8 TRCN0000174509 CCAGGATGAATATATCTTCAT pLKO.1 1334 CDS 100% 0.495 0.347 N Sorcs3 n/a
9 TRCN0000175676 GCAAGACATTGGCAATGTCAT pLKO.1 3212 CDS 100% 0.495 0.347 N Sorcs3 n/a
10 TRCN0000193937 CCACAATGCAACCTTCATCAT pLKO.1 2660 CDS 100% 4.950 2.970 N Sorcs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025696.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488612 GTGGATCTCCCCGGTCACGTTGGC pLX_317 8.2% 88.2% 92.3% V5 (many diffs) n/a
2 TRCN0000491737 TACACAACTTACAGCATTCAAGTC pLX_317 7.2% 88.2% 92.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV