Transcript: Human NM_001130970.1

Homo sapiens NMDA receptor synaptonuclear signaling and neuronal migration factor (NSMF), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NSMF (26012)
Length:
3583
CDS:
233..1756

Additional Resources:

NCBI RefSeq record:
NM_001130970.1
NBCI Gene record:
NSMF (26012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165267 GTGTCTGACGACATCCCTATT pLKO.1 854 CDS 100% 10.800 15.120 N NSMF n/a
2 TRCN0000165544 GACGTACTTTGACTTCCGGTT pLKO.1 1675 CDS 100% 2.160 3.024 N NSMF n/a
3 TRCN0000165939 GCAGATGATCGAGACGTACTT pLKO.1 1663 CDS 100% 4.950 3.960 N NSMF n/a
4 TRCN0000165391 CCAGACAGCAACCACAACTAT pLKO.1 910 CDS 100% 5.625 3.938 N NSMF n/a
5 TRCN0000165955 GCTGCTGTTGAGTTCAGCTTT pLKO.1 2537 3UTR 100% 4.950 3.465 N NSMF n/a
6 TRCN0000164926 GAAGCTGAACGTCTACCACAA pLKO.1 1342 CDS 100% 4.050 2.835 N NSMF n/a
7 TRCN0000161947 GCTTTCACTTACACTCCTCTT pLKO.1 2358 3UTR 100% 4.050 2.835 N NSMF n/a
8 TRCN0000165475 GAAGCAGATGATCGAGACGTA pLKO.1 1660 CDS 100% 2.640 1.848 N NSMF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02902 pDONR223 100% 99.6% 99.6% None 704_709delCCATCT n/a
2 ccsbBroad304_02902 pLX_304 0% 99.6% 99.6% V5 704_709delCCATCT n/a
3 TRCN0000465661 CGCGGCTGACCCGATGTCTGCTGA pLX_317 17% 99.6% 99.6% V5 704_709delCCATCT n/a
4 ccsbBroadEn_02903 pDONR223 100% 95.8% 95.6% None 704_705ins53;706A>G;710_710delCinsGTAATCCAGAG n/a
5 ccsbBroad304_02903 pLX_304 0% 95.8% 95.6% V5 704_705ins53;706A>G;710_710delCinsGTAATCCAGAG n/a
6 TRCN0000478064 GAGTCTTCTGTGTTCATACAGTCC pLX_317 2.4% 95.8% 95.6% V5 704_705ins53;706A>G;710_710delCinsGTAATCCAGAG n/a
Download CSV