Transcript: Human NR_002718.2

Homo sapiens teratocarcinoma-derived growth factor 1 pseudogene 3 (TDGF1P3), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
TDGF1P3 (6998)
Length:
2710
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002718.2
NBCI Gene record:
TDGF1P3 (6998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427409 AGAAGTGTTCCCTGTGTAAAT pLKO_005 1195 3UTR 100% 13.200 6.600 Y TDGF1 n/a
2 TRCN0000004893 ACAGCACAGTAAGGAGCTAAA pLKO.1 1034 3UTR 100% 10.800 5.400 Y TDGF1 n/a
3 TRCN0000004889 GCTAAATGGAAGGGCAAGTTT pLKO.1 2283 3UTR 100% 5.625 2.813 Y TDGF1 n/a
4 TRCN0000004890 CCTTTCTATACAAAGCTACTA pLKO.1 1361 3UTR 100% 4.950 2.475 Y TDGF1 n/a
5 TRCN0000004892 GTCTGCACGTACTACCACTTT pLKO.1 1322 3UTR 100% 4.950 2.475 Y TDGF1 n/a
6 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 1868 3UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07044 pDONR223 100% 20.5% None (many diffs) n/a
2 ccsbBroad304_07044 pLX_304 0% 20.5% V5 (many diffs) n/a
3 TRCN0000467482 AGTCTCGTCGGTGTAACGGGCATC pLX_317 56.8% 20.5% V5 (many diffs) n/a
4 TRCN0000491650 TCCGTCTAGAGTCACAAATTTTGC pLX_317 65.4% 20.5% V5 (many diffs) n/a
5 TRCN0000487858 TGCGGACGGCCTCTATATGGGTCC pLX_317 47.1% 20.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_07043 pDONR223 100% 20.5% None (many diffs) n/a
7 ccsbBroad304_07043 pLX_304 0% 20.5% V5 (many diffs) n/a
8 TRCN0000473604 GCAGTAGTAGTCGAAATACGGGCG pLX_317 47% 20.5% V5 (many diffs) n/a
9 ccsbBroadEn_11616 pDONR223 100% 6.3% None (many diffs) n/a
10 ccsbBroad304_11616 pLX_304 0% 6.3% V5 (many diffs) n/a
11 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 6.3% V5 (many diffs) n/a
Download CSV