Transcript: Mouse NM_001205371.1

Mus musculus cancer susceptibility candidate 4 (Casc4), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Casc4 (319996)
Length:
3805
CDS:
183..1133

Additional Resources:

NCBI RefSeq record:
NM_001205371.1
NBCI Gene record:
Casc4 (319996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135587 GCTCTAAACTGGCGGATTATA pLKO.1 940 CDS 100% 15.000 12.000 N CASC4 n/a
2 TRCN0000191261 CAAATCCTCTTCAGCACATAA pLKO.1 775 CDS 100% 13.200 9.240 N Casc4 n/a
3 TRCN0000201042 CAGCTTCAAGACTACAGGAAA pLKO.1 252 CDS 100% 4.950 3.465 N Casc4 n/a
4 TRCN0000190923 CAGGAGTTTCTTCGACAGGAA pLKO.1 228 CDS 100% 2.640 1.584 N Casc4 n/a
5 TRCN0000136161 GATGATGAAGAACGAGAGCTT pLKO.1 1062 CDS 100% 2.640 1.584 N CASC4 n/a
6 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 3666 3UTR 100% 2.640 1.320 Y P3h3 n/a
7 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 3666 3UTR 100% 2.640 1.320 Y P3h3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2766 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13019 pDONR223 100% 62.5% 58% None (many diffs) n/a
2 ccsbBroad304_13019 pLX_304 0% 62.5% 58% V5 (many diffs) n/a
3 TRCN0000478915 AAGTGCTATTCTTCTGGTCCATGC pLX_317 27.5% 62.5% 58% V5 (many diffs) n/a
Download CSV