Transcript: Human NM_001282734.1

Homo sapiens solute carrier family 39 member 12 (SLC39A12), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SLC39A12 (221074)
Length:
2461
CDS:
329..2002

Additional Resources:

NCBI RefSeq record:
NM_001282734.1
NBCI Gene record:
SLC39A12 (221074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042906 GCTGGGATGTTCTTATATTTA pLKO.1 1838 CDS 100% 15.000 12.000 N SLC39A12 n/a
2 TRCN0000378989 ACCAGATGCACTATTACTAAT pLKO_005 196 5UTR 100% 13.200 10.560 N SLC39A12 n/a
3 TRCN0000042903 CCCAGACTACTTTACAGAATA pLKO.1 613 CDS 100% 13.200 10.560 N SLC39A12 n/a
4 TRCN0000373615 ATGAAAGCAAAGGTCATATTT pLKO_005 1242 CDS 100% 15.000 10.500 N SLC39A12 n/a
5 TRCN0000042905 CCTCAGGTTCTTGGTTTACAT pLKO.1 1190 CDS 100% 5.625 3.938 N SLC39A12 n/a
6 TRCN0000079773 CCACATGAAATGGGAGACTTT pLKO.1 1673 CDS 100% 4.950 3.465 N Slc39a12 n/a
7 TRCN0000042907 CGCCTATCAGAACTAGACCAA pLKO.1 668 CDS 100% 2.640 1.848 N SLC39A12 n/a
8 TRCN0000373616 TCTCCTGCTCTTGGCTATATA pLKO_005 1960 CDS 100% 15.000 9.000 N SLC39A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09864 pDONR223 100% 80.6% 80.6% None 0_1ins402 n/a
2 ccsbBroad304_09864 pLX_304 0% 80.6% 80.6% V5 0_1ins402 n/a
3 TRCN0000481463 CACGCGACATGTAATATTTTATAA pLX_317 22% 80.6% 80.6% V5 0_1ins402 n/a
4 ccsbBroadEn_16128 pDONR223 0% 38.8% 32.1% None (many diffs) n/a
5 ccsbBroad304_16128 pLX_304 0% 38.8% 32.1% V5 (many diffs) n/a
Download CSV